ID: 1144986672

View in Genome Browser
Species Human (GRCh38)
Location 17:19205318-19205340
Sequence GATGAAAAGAGGCCCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144986672_1144986677 -2 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data
1144986672_1144986685 16 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG No data
1144986672_1144986679 9 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986679 17:19205350-19205372 GCCAAGCCCTGGAGTCCAGCTGG No data
1144986672_1144986688 29 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986672_1144986683 15 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986683 17:19205356-19205378 CCCTGGAGTCCAGCTGGGCACGG No data
1144986672_1144986681 10 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986681 17:19205351-19205373 CCAAGCCCTGGAGTCCAGCTGGG No data
1144986672_1144986687 28 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986687 17:19205369-19205391 CTGGGCACGGGCAGTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144986672 Original CRISPR GATGAAAAGAGGCCCCTCCC TGG (reversed) Intergenic
No off target data available for this crispr