ID: 1144986676

View in Genome Browser
Species Human (GRCh38)
Location 17:19205329-19205351
Sequence GCAGTCCCCAGGATGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144986676_1144986679 -2 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986679 17:19205350-19205372 GCCAAGCCCTGGAGTCCAGCTGG No data
1144986676_1144986689 22 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986689 17:19205374-19205396 CACGGGCAGTCAGCCTGGGCTGG No data
1144986676_1144986691 24 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986691 17:19205376-19205398 CGGGCAGTCAGCCTGGGCTGGGG No data
1144986676_1144986690 23 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986690 17:19205375-19205397 ACGGGCAGTCAGCCTGGGCTGGG No data
1144986676_1144986693 29 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986693 17:19205381-19205403 AGTCAGCCTGGGCTGGGGGATGG No data
1144986676_1144986685 5 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG No data
1144986676_1144986683 4 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986683 17:19205356-19205378 CCCTGGAGTCCAGCTGGGCACGG No data
1144986676_1144986688 18 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986676_1144986681 -1 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986681 17:19205351-19205373 CCAAGCCCTGGAGTCCAGCTGGG No data
1144986676_1144986692 25 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986692 17:19205377-19205399 GGGCAGTCAGCCTGGGCTGGGGG No data
1144986676_1144986687 17 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986687 17:19205369-19205391 CTGGGCACGGGCAGTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144986676 Original CRISPR GCAGTCCCCAGGATGAAAAG AGG (reversed) Intergenic
No off target data available for this crispr