ID: 1144986677

View in Genome Browser
Species Human (GRCh38)
Location 17:19205339-19205361
Sequence TCCTGGGGACTGCCAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144986660_1144986677 24 Left 1144986660 17:19205292-19205314 CCCCCAGGCAGAGTGACTTGAAG No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data
1144986672_1144986677 -2 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data
1144986671_1144986677 -1 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data
1144986665_1144986677 21 Left 1144986665 17:19205295-19205317 CCAGGCAGAGTGACTTGAAGGGC No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data
1144986663_1144986677 22 Left 1144986663 17:19205294-19205316 CCCAGGCAGAGTGACTTGAAGGG No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data
1144986661_1144986677 23 Left 1144986661 17:19205293-19205315 CCCCAGGCAGAGTGACTTGAAGG No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144986677 Original CRISPR TCCTGGGGACTGCCAAGCCC TGG Intergenic
No off target data available for this crispr