ID: 1144986678

View in Genome Browser
Species Human (GRCh38)
Location 17:19205340-19205362
Sequence TCCAGGGCTTGGCAGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144986678_1144986688 7 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986678_1144986693 18 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986693 17:19205381-19205403 AGTCAGCCTGGGCTGGGGGATGG No data
1144986678_1144986683 -7 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986683 17:19205356-19205378 CCCTGGAGTCCAGCTGGGCACGG No data
1144986678_1144986691 13 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986691 17:19205376-19205398 CGGGCAGTCAGCCTGGGCTGGGG No data
1144986678_1144986692 14 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986692 17:19205377-19205399 GGGCAGTCAGCCTGGGCTGGGGG No data
1144986678_1144986689 11 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986689 17:19205374-19205396 CACGGGCAGTCAGCCTGGGCTGG No data
1144986678_1144986695 25 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986695 17:19205388-19205410 CTGGGCTGGGGGATGGTGCCTGG No data
1144986678_1144986685 -6 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG No data
1144986678_1144986687 6 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986687 17:19205369-19205391 CTGGGCACGGGCAGTCAGCCTGG No data
1144986678_1144986690 12 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986690 17:19205375-19205397 ACGGGCAGTCAGCCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144986678 Original CRISPR TCCAGGGCTTGGCAGTCCCC AGG (reversed) Intergenic
No off target data available for this crispr