ID: 1144986679

View in Genome Browser
Species Human (GRCh38)
Location 17:19205350-19205372
Sequence GCCAAGCCCTGGAGTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144986671_1144986679 10 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986679 17:19205350-19205372 GCCAAGCCCTGGAGTCCAGCTGG No data
1144986672_1144986679 9 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986679 17:19205350-19205372 GCCAAGCCCTGGAGTCCAGCTGG No data
1144986676_1144986679 -2 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986679 17:19205350-19205372 GCCAAGCCCTGGAGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144986679 Original CRISPR GCCAAGCCCTGGAGTCCAGC TGG Intergenic
No off target data available for this crispr