ID: 1144986688

View in Genome Browser
Species Human (GRCh38)
Location 17:19205370-19205392
Sequence TGGGCACGGGCAGTCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144986671_1144986688 30 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986684_1144986688 -10 Left 1144986684 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986680_1144986688 -4 Left 1144986680 17:19205351-19205373 CCAAGCCCTGGAGTCCAGCTGGG No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986672_1144986688 29 Left 1144986672 17:19205318-19205340 CCAGGGAGGGGCCTCTTTTCATC No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986678_1144986688 7 Left 1144986678 17:19205340-19205362 CCTGGGGACTGCCAAGCCCTGGA No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986676_1144986688 18 Left 1144986676 17:19205329-19205351 CCTCTTTTCATCCTGGGGACTGC No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data
1144986682_1144986688 -9 Left 1144986682 17:19205356-19205378 CCCTGGAGTCCAGCTGGGCACGG No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144986688 Original CRISPR TGGGCACGGGCAGTCAGCCT GGG Intergenic
No off target data available for this crispr