ID: 1144990807

View in Genome Browser
Species Human (GRCh38)
Location 17:19232424-19232446
Sequence GACTCAGGCTCAGAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 2, 1: 0, 2: 6, 3: 45, 4: 378}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144990804_1144990807 -1 Left 1144990804 17:19232402-19232424 CCAGGGAGAGAAAGCTCTGATTG 0: 1
1: 1
2: 0
3: 16
4: 208
Right 1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG 0: 2
1: 0
2: 6
3: 45
4: 378
1144990799_1144990807 22 Left 1144990799 17:19232379-19232401 CCCATTCCTGAACTAATCACTGA 0: 2
1: 0
2: 16
3: 88
4: 387
Right 1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG 0: 2
1: 0
2: 6
3: 45
4: 378
1144990802_1144990807 16 Left 1144990802 17:19232385-19232407 CCTGAACTAATCACTGACCAGGG 0: 2
1: 0
2: 1
3: 22
4: 117
Right 1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG 0: 2
1: 0
2: 6
3: 45
4: 378
1144990800_1144990807 21 Left 1144990800 17:19232380-19232402 CCATTCCTGAACTAATCACTGAC 0: 2
1: 0
2: 4
3: 50
4: 309
Right 1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG 0: 2
1: 0
2: 6
3: 45
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144990807 Original CRISPR GACTCAGGCTCAGAGCTGGA AGG Intronic
902223557 1:14982141-14982163 CACTGAGGCTCAGGGCTGGAAGG + Intronic
902257238 1:15197830-15197852 GACATAGTTTCAGAGCTGGAGGG - Intronic
903779031 1:25810030-25810052 GTCCCAGGCACAGAGGTGGAGGG - Intronic
904287290 1:29460793-29460815 GACTGAGGCTCAGAGGTGAAGGG + Intergenic
904417746 1:30373455-30373477 GACTGAGGCTCAGAGGTGAAGGG - Intergenic
904436976 1:30505381-30505403 TTCACAGGCTCACAGCTGGAAGG + Intergenic
904451740 1:30617292-30617314 GAATCAGGGTGGGAGCTGGAGGG + Intergenic
905009549 1:34737999-34738021 GACTGAGGCACAGAGATGGTGGG - Intronic
905517365 1:38571696-38571718 GACCCAGCTTCAGAACTGGATGG - Intergenic
905536800 1:38728718-38728740 AACTCAGGCTCAGAGCTGGCAGG - Intergenic
906153808 1:43602564-43602586 CACTCAAGGCCAGAGCTGGAGGG + Intronic
907319143 1:53592010-53592032 CACTCATGCTCAGAGATGGGTGG - Intronic
907689299 1:56645840-56645862 CCTACAGGCTCAGAGCTGGAAGG - Intronic
907847537 1:58222899-58222921 CACTGAGGCTCAGAGGTGAAGGG + Intronic
908061851 1:60358652-60358674 GAATCAGGCTCAGAGAATGAAGG + Intergenic
909699818 1:78510787-78510809 GTCACAGGCTCATAGGTGGAAGG - Intronic
910652274 1:89582425-89582447 GACTATGGTTCAGAGTTGGATGG + Intronic
913277593 1:117154182-117154204 GACTCATGCTCGGAGCAGGCAGG + Intronic
913452228 1:119000177-119000199 TACTCAAGCTCAAAGCTAGAAGG + Intergenic
918078933 1:181190978-181191000 GATTCTAGCTCAGAGCTGAAGGG + Intergenic
918645553 1:186900149-186900171 GACTCAGACTCAGAGTCAGATGG + Intronic
920647996 1:207817341-207817363 GACTCAGGCTCAGCTGAGGATGG - Intergenic
921757882 1:218880710-218880732 GCCTCAGGCACAGAGCTGGATGG + Intergenic
922722156 1:227904667-227904689 GCCTGAGGCTCACAGCAGGAAGG - Intergenic
923405525 1:233655303-233655325 TTCACAGGCTCACAGCTGGAGGG + Intronic
924123853 1:240829563-240829585 GGCTCAGGCTTAGGGATGGAAGG - Intronic
924477683 1:244395858-244395880 GACTCAAGCTCAGAGAGGGAAGG - Intergenic
1064909520 10:20384800-20384822 TGCACAGGCTCACAGCTGGAGGG + Intergenic
1066283091 10:33937482-33937504 GAATCAGACTCACAGCTAGAGGG - Intergenic
1067041572 10:42955845-42955867 GCCTGAGACTCAGGGCTGGATGG - Intergenic
1067180831 10:43984898-43984920 GACCCAGGCTAACAGTTGGAGGG - Intergenic
1067437372 10:46287520-46287542 GACCCAGGGCCAGAGCTAGAAGG - Intronic
1068299601 10:55121342-55121364 TTCACAGGCTCAGAGCTGGGGGG + Intronic
1069566200 10:69465003-69465025 GACTCAGCCTCTGACCTGGGAGG + Intronic
1069590448 10:69638525-69638547 GGTTCAGGGTCAGAGCTGCAAGG - Intergenic
1069676313 10:70251239-70251261 GAGCCAAGCCCAGAGCTGGATGG - Exonic
1069910440 10:71755527-71755549 AACTGAGGCTCAGAGAGGGAAGG + Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1070819084 10:79344320-79344342 GACTGAAGCTCAGAGAAGGATGG - Intergenic
1072225843 10:93368082-93368104 GACCCAGCCACAGAGCTGGAGGG + Intronic
1073267737 10:102238348-102238370 GACTCAGGTTCAGGACGGGAGGG - Intronic
1073686338 10:105758482-105758504 GATTAAGGCTCAGAGTTGTAAGG + Intergenic
1074033710 10:109716265-109716287 GATTGAAGTTCAGAGCTGGATGG - Intergenic
1074290371 10:112133655-112133677 GACTCAGTCTCTGACTTGGACGG + Intergenic
1074434446 10:113421816-113421838 GACTCAAGCCCAGATCTGAAAGG - Intergenic
1074554713 10:114477730-114477752 GACTCTGTCTCAGAGAAGGAAGG - Intronic
1074619823 10:115107236-115107258 TTCACAGGCTCACAGCTGGAAGG - Intronic
1075240472 10:120773959-120773981 GACAAAGGCACAGAACTGGAAGG + Intergenic
1076138341 10:128060387-128060409 GAGTCTGCCCCAGAGCTGGAAGG - Intronic
1076465428 10:130678008-130678030 TCCTCAGGCTCAGAGCTTGGTGG + Intergenic
1076538823 10:131200585-131200607 TTCGCAGGCTCACAGCTGGAGGG + Intronic
1076589587 10:131574011-131574033 ACCACAGGCTCACAGCTGGAAGG + Intergenic
1076804363 10:132847678-132847700 GCCTCAGCCTCAGTGCTGGCTGG - Intronic
1077254425 11:1573939-1573961 GATTCAGGCTGAGACCCGGAGGG + Intergenic
1077370157 11:2177993-2178015 GGCTCAGGCTTAGGGCTGGAGGG - Intergenic
1077370252 11:2178335-2178357 GGCTCAGGCTTGGGGCTGGAGGG + Intergenic
1077728139 11:4697772-4697794 GAGACAGGCACAGAGCTGAAAGG + Exonic
1077780692 11:5326081-5326103 GACCCAAGCTTAGAGATGGAGGG - Intronic
1077992799 11:7426800-7426822 GACTCACGCTCAGACCTCCAAGG + Intronic
1078009683 11:7563163-7563185 GAGTCAGGCTAAAAGGTGGATGG - Intronic
1078551055 11:12280925-12280947 GACTCTGTGTCAGAGCTGGAAGG - Intronic
1079108795 11:17591736-17591758 GGCACAAGCTCAGGGCTGGATGG + Intronic
1079582030 11:22077535-22077557 AACTCAGTCTCAGGTCTGGAAGG - Intergenic
1082960325 11:58913274-58913296 GCCTGAGGCTGGGAGCTGGAGGG + Intronic
1083475537 11:62912743-62912765 GCCTGAGGCCCAGAGCAGGAAGG - Intronic
1084785101 11:71437577-71437599 GATGCCGGCTCAGGGCTGGATGG - Intronic
1084925957 11:72511379-72511401 GACTCAGACACTGAGCTGAAGGG - Intergenic
1085045174 11:73348561-73348583 TAGTCAGACTCAGAGATGGAAGG + Intronic
1085249878 11:75135827-75135849 GAAACAGGCTCAGAGGTGAAAGG + Intronic
1085299503 11:75450005-75450027 GACAGAGGCTCAGAGCGGGTGGG + Intronic
1085967125 11:81540651-81540673 AACTCAGGCCAAGAGCTGTAAGG + Intergenic
1086761265 11:90634327-90634349 GACCAAGGCTCAGGGCTAGAGGG + Intergenic
1087205700 11:95391691-95391713 TTCACAGGCTCACAGCTGGAAGG - Intergenic
1088148112 11:106708629-106708651 CACTCAGGCTCCGTGCTGGCTGG - Exonic
1089798698 11:121005590-121005612 GACTCAGGCTCAGAGGGGCCTGG - Intergenic
1090659910 11:128874477-128874499 GACTAATGCTCATAGTTGGACGG + Intergenic
1091349068 11:134878503-134878525 GACTCAGGCTAAGAACTGCATGG + Intergenic
1092042875 12:5400742-5400764 GACTAAGACTCAGAGATGGAAGG - Intergenic
1092368578 12:7897659-7897681 TACTCAGGCGCGGAGATGGAAGG - Intergenic
1092508527 12:9128303-9128325 GACTGAGGATCTGAGCTGGGAGG + Intergenic
1092674282 12:10899154-10899176 TTCACAGGCTCATAGCTGGAAGG + Intronic
1093938331 12:25025431-25025453 GATGCAGGCCAAGAGCTGGAGGG + Intronic
1094564293 12:31585626-31585648 GACTGAGGCTCAGAGATTAAGGG - Intronic
1096186988 12:49587892-49587914 GATTCAGACTCAGTGTTGGAGGG - Intronic
1096238334 12:49944786-49944808 GTATCAGGCTCAGAGATGAAAGG + Intergenic
1096513236 12:52143428-52143450 GCCTCGGGCTCAGTGATGGAGGG - Intergenic
1096516635 12:52159638-52159660 GTCACAGGCTCACAGATGGAGGG - Intergenic
1096534325 12:52261465-52261487 GAACCAGGCTCAGAGCATGAAGG + Intronic
1096542778 12:52317559-52317581 AACCCAGGCTCACGGCTGGAGGG - Intronic
1096614410 12:52823717-52823739 AACTGAGGCACAGAGCAGGAAGG - Intronic
1097016757 12:55992708-55992730 GAATAAAGCTCAGAGCAGGAGGG + Exonic
1097264255 12:57736837-57736859 GACTCAGCCTCAGAGCTTTCTGG - Intronic
1097681756 12:62655962-62655984 GGCTCAGGCTCTGAGCGGGAGGG + Intronic
1100032617 12:90211065-90211087 AACTCAGGCTCAGAATTTGAAGG - Intergenic
1102033048 12:109753978-109754000 GACAGAGGCTCAGAGATGAAGGG + Intronic
1102413906 12:112743929-112743951 TAATCAGGCTCAGAGCCTGAGGG - Intronic
1102720589 12:115012990-115013012 GGCTGAGGCTGAGAGATGGATGG - Intergenic
1103459644 12:121093651-121093673 GACTCAGGCTCAGGCATGGGGGG + Intergenic
1104259552 12:127170412-127170434 GACTGAGGTTCAGACCTGGGAGG - Intergenic
1106496973 13:30287052-30287074 GAAGCAGGCTCATAGGTGGAAGG + Intronic
1108244853 13:48504017-48504039 GACTTAGGCTCAGAACTTCAGGG + Intronic
1108701484 13:52947953-52947975 GACCCAGGCGCTGAGCTGGGTGG + Intergenic
1109423615 13:62145389-62145411 CTTTCAGGCTCAGAGGTGGAAGG - Intergenic
1109710241 13:66149766-66149788 GCCTCAGGCTCAAAGAGGGAAGG - Intergenic
1109922585 13:69088275-69088297 TTCACAGGCTCACAGCTGGAGGG + Intergenic
1111355177 13:87090300-87090322 GCCACATCCTCAGAGCTGGAAGG - Intergenic
1113662622 13:112117711-112117733 GTCTCAGGGCCACAGCTGGAGGG + Intergenic
1113970059 13:114181831-114181853 CACTCAGGCTCTGAGGGGGAAGG - Intergenic
1119109857 14:71961298-71961320 GGGTCTAGCTCAGAGCTGGAAGG + Intronic
1119128044 14:72146511-72146533 TTCACAGGCTCACAGCTGGAGGG - Intronic
1119737933 14:76995738-76995760 GGCTGGGGCTCAGAGCTGGAAGG - Intergenic
1119846260 14:77832521-77832543 GCCTCAGGCTCAGAGGAGGGAGG - Intronic
1120898902 14:89558798-89558820 GCCGTAGGCTCACAGCTGGAAGG + Intronic
1121022422 14:90588483-90588505 GACCCTGGCTCAGTGCTGAAGGG + Intronic
1121699827 14:95944214-95944236 AACTGAGGCCCAGAGATGGAAGG + Intergenic
1122786770 14:104167583-104167605 GCCCCAGGCTCAGAGCTCCAGGG - Intronic
1124516607 15:30371954-30371976 GATTCGGGCTCCGTGCTGGACGG - Intronic
1124726312 15:32158777-32158799 GATTCGGGCTCCGTGCTGGACGG + Intronic
1125485235 15:40106934-40106956 GTCTCAGGTTCAGAGCTGGCAGG - Intronic
1126548800 15:49904195-49904217 GACTAAGACACAGTGCTGGAGGG + Intronic
1128109834 15:65069138-65069160 GGCCCAGGGTCAGAGCTGGATGG + Intronic
1128340661 15:66820587-66820609 GGCTCAGGCTCAGAAGTGCAGGG + Intergenic
1128521810 15:68380337-68380359 AACTGAGGCTCAGAGATGGCAGG - Intronic
1128607685 15:69048923-69048945 GACCCAGCCTCTGAGCTGAAGGG + Intronic
1129372395 15:75105735-75105757 AACTGAGGCTCAGAGAAGGACGG - Intronic
1129999539 15:80034861-80034883 GACACAGCCTCAGAGCTGGAGGG + Intergenic
1130401154 15:83555566-83555588 GATCCAGTCACAGAGCTGGAGGG + Intronic
1130676937 15:85961153-85961175 GACACAGACTCAGAGATGGCAGG + Intergenic
1130953454 15:88610550-88610572 GTCTCAGGCTGACAGCTGGAAGG + Intergenic
1131166506 15:90145638-90145660 TACTCGGGCCCAGAGCTGGTGGG + Intergenic
1132064600 15:98720346-98720368 AACTGAATCTCAGAGCTGGAAGG - Intronic
1132375187 15:101324083-101324105 GACTCGGACTCAGAGCCGCAAGG - Intronic
1132394951 15:101465501-101465523 CACTCTGGCTCTGAGCTGGCGGG + Intronic
1132734202 16:1377575-1377597 GGCACAGGCGCAGGGCTGGAGGG - Intronic
1132743252 16:1426369-1426391 GAGTCAGGGGCAGAGCTGGAAGG + Intergenic
1132939835 16:2501158-2501180 GCATCTGGGTCAGAGCTGGAGGG + Exonic
1133184547 16:4086183-4086205 GACACTGGCACAAAGCTGGAAGG + Intronic
1133327176 16:4948892-4948914 GCCTCAGGCACTGAGCTGGGGGG + Intronic
1134029254 16:10978574-10978596 GACTGAGGCTTTGAGCCGGAGGG + Intronic
1135184182 16:20300572-20300594 GACACAGAATTAGAGCTGGAAGG - Intergenic
1135253998 16:20926067-20926089 AAAACAGGCTCACAGCTGGAGGG - Intergenic
1135888496 16:26335649-26335671 GGCTCTGTCCCAGAGCTGGAAGG + Intergenic
1136146798 16:28320902-28320924 GACTCAGACGCAGATCTCGATGG - Exonic
1136403663 16:30031260-30031282 GGCTGTGGCTCAGAGCTGCATGG - Intronic
1138558501 16:57786642-57786664 GCCCCAGGCTCCGAGGTGGAGGG - Intronic
1139355839 16:66366690-66366712 CACTCACGCTCAGCCCTGGACGG + Exonic
1139908516 16:70382206-70382228 GCCTGGGGCTCAGAGCTGGTGGG + Intronic
1140046560 16:71443522-71443544 AACTGAGGCCCAGAGATGGATGG - Intergenic
1140222447 16:73053762-73053784 GCCACAGGCTCTGAGCTGAAAGG + Intronic
1140487611 16:75306278-75306300 GACCCAGTCTCAGAGTTGGAAGG + Intronic
1141064137 16:80900400-80900422 GATGGAGGCCCAGAGCTGGACGG - Intergenic
1141467706 16:84217690-84217712 GATTAAGGCTCAGAGAGGGAGGG - Intergenic
1141539574 16:84709380-84709402 GTCTTGGGCACAGAGCTGGAGGG + Intronic
1141692316 16:85603228-85603250 GACCCAAGCTCTGAGATGGAGGG - Intergenic
1142244455 16:88963145-88963167 GACACAGGCCCAGGGCCGGAGGG + Intronic
1142522853 17:517338-517360 CACTCAGGATCAGAGCTGGACGG + Exonic
1142684669 17:1571028-1571050 GGCTCAGTCTCAGAGCTGCCCGG + Intronic
1142748222 17:1971502-1971524 AACTGAGGCTCTGAGCAGGAAGG + Intronic
1143011260 17:3867435-3867457 GAAGCAGGCTCTGAGCTGGGAGG + Intronic
1143197774 17:5089268-5089290 GACTGGGGATCACAGCTGGAAGG - Intronic
1143323995 17:6086705-6086727 GATTCAGGCCCAGAAGTGGATGG + Intronic
1143712240 17:8742980-8743002 GGCTTAGGCACAGAGCAGGAAGG + Intronic
1144796958 17:17898267-17898289 GTCTCAGTCTCAGAGCAGGCTGG + Intronic
1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG + Intergenic
1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG + Intronic
1145245731 17:21268207-21268229 AACTGAGGCCCAGAGGTGGAGGG + Intergenic
1145268783 17:21393230-21393252 CGCTGAGGCTCAGAGGTGGAGGG + Intronic
1146849959 17:36213437-36213459 GGCTGAGGCTCAGAGGGGGAAGG - Intronic
1147401135 17:40180660-40180682 AACTGAGGCCCAGAGCTGGGAGG - Intronic
1147556574 17:41483097-41483119 AACTGAGACTCAGAGATGGAAGG + Intergenic
1148090755 17:45021294-45021316 GAAACAGTCTCAGAGCAGGAGGG - Intergenic
1148213598 17:45822534-45822556 GCCTAAAGATCAGAGCTGGAAGG + Intronic
1148666156 17:49376590-49376612 GACTTAAGCCCAGAGCTGTAAGG + Intronic
1149576053 17:57714425-57714447 TACTCAGGCTCAGAGAAGGAAGG - Intergenic
1151417032 17:73973293-73973315 GGCTGAATCTCAGAGCTGGAAGG - Intergenic
1151902162 17:77023566-77023588 GCCTCAGCCTCATAGGTGGAAGG + Intergenic
1152450599 17:80376917-80376939 GGCTCAAGCTCGGAGGTGGAAGG + Exonic
1152539853 17:80969427-80969449 GAGTCAGGCACAGACCAGGAAGG + Intergenic
1152586983 17:81193562-81193584 GCCCCAAGGTCAGAGCTGGAGGG + Intronic
1152617641 17:81345313-81345335 GCCTCGGCCTCAGAGCTGGGAGG - Intergenic
1153038759 18:790366-790388 AACTCCGTCTCAGAGCTGGCGGG + Intronic
1153227626 18:2910319-2910341 GACTCAGGCTCCCAGCTGAAGGG - Intronic
1155386156 18:25280061-25280083 ATCACAGGCTCAGAGCTGGAAGG + Intronic
1157418125 18:47522982-47523004 GACTCAGAGTCACTGCTGGAAGG - Intergenic
1157446851 18:47752815-47752837 CACTCAGAGTCAGAGCTGGGAGG + Intergenic
1158770301 18:60508191-60508213 GACTCAGGCTCATCTCAGGAAGG - Intergenic
1159449620 18:68583618-68583640 GCCTCAGGCTCAGGGCTCGATGG - Intergenic
1161021009 19:2011494-2011516 GCCCCAGGCTCAGGGATGGAAGG - Intronic
1161930562 19:7336785-7336807 GAGTCAGGCTGAGAGCTGGGTGG + Intergenic
1161980138 19:7626072-7626094 GTCTCAGGCTCAGTCATGGAGGG + Intronic
1162567260 19:11451232-11451254 GACCCAGGCCCAGAGAAGGACGG + Intergenic
1162851956 19:13437832-13437854 CACTCCTGATCAGAGCTGGATGG - Intronic
1162966564 19:14159019-14159041 GACGCTGGCACAGAGCTGGGGGG + Intronic
1163584111 19:18154733-18154755 AACTGAGGCTCAGAGCAGGGAGG - Intronic
1164558397 19:29270701-29270723 GGCTCAGCATCAAAGCTGGAAGG - Intergenic
1165242683 19:34481097-34481119 GCCTCAGGCTCAGAGCCGGTGGG - Intergenic
1167454097 19:49589783-49589805 GACACTGGGACAGAGCTGGAAGG - Intronic
1168271065 19:55250069-55250091 GCCTGAGGCACAGTGCTGGATGG + Intronic
925572875 2:5330466-5330488 CACTCAGGCTCAGAGGGGCATGG + Intergenic
925610258 2:5696387-5696409 GACCCAGGCTACGAGCGGGAGGG + Exonic
925972290 2:9113897-9113919 CAAACACGCTCAGAGCTGGAAGG - Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
927338948 2:21958440-21958462 GACTCAGATTCTGAGGTGGAAGG + Intergenic
927697333 2:25247250-25247272 GAGTCAGTCTCAGCCCTGGAGGG + Intronic
927871955 2:26629403-26629425 GACTCACCCGCAGAGCTGGCAGG + Exonic
928478236 2:31653316-31653338 GACTCAAACTCTGAGATGGAGGG - Intergenic
929547011 2:42862454-42862476 GGCTCAGCCTCTGAGGTGGAAGG - Intergenic
929699504 2:44149774-44149796 GACTCAGGAGAAGAGCTGTAGGG + Intergenic
929699703 2:44151368-44151390 TTCCCAGGCTCACAGCTGGAGGG + Intergenic
929753503 2:44742123-44742145 GACTCAGGCTCAGTGAGAGATGG - Intronic
929805117 2:45138346-45138368 GACTCAGGGACAGAGGAGGAAGG + Intergenic
931668355 2:64625849-64625871 GACACAGAGTCAGAGATGGAGGG + Intergenic
932773476 2:74514273-74514295 GAGCCAGGCTCAGCGCGGGAGGG - Intronic
933759679 2:85665100-85665122 GGCTCAGGCTCAGGCCTGGTAGG - Intronic
933773241 2:85756699-85756721 CACTGAGGCCCAGAGATGGAAGG + Intronic
933773354 2:85757331-85757353 GACTGAGGCCCAGAGGAGGAAGG - Intronic
935699231 2:105796580-105796602 GACTGAGCCTGGGAGCTGGAAGG + Intronic
936401938 2:112171285-112171307 GACTCAGGCAGAGACCTGCAGGG + Intronic
938186654 2:129238112-129238134 TACAAAGGCTCACAGCTGGATGG + Intergenic
943517133 2:188903021-188903043 GACACAGGATCAGAGCTGGAAGG - Intergenic
946855068 2:223943766-223943788 CACTCAGGCCCAGAGCTGGTGGG + Intronic
947549917 2:231038301-231038323 AACTGAGGCTCAGAGCAGGGAGG + Intronic
948055437 2:235006760-235006782 GATGGAGGGTCAGAGCTGGAGGG - Intronic
1171376921 20:24700083-24700105 GGCTGAGGCTCAGAGCAGGATGG - Intergenic
1171456248 20:25274314-25274336 GACACATGCTCCGATCTGGATGG - Intronic
1172047463 20:32090616-32090638 GTCACAGCATCAGAGCTGGAAGG - Intronic
1172145997 20:32758972-32758994 GACTGAGGCCCAGAGAAGGAAGG - Intergenic
1173597386 20:44267764-44267786 GACCCAGGGTCTGAACTGGATGG + Intronic
1173626301 20:44475679-44475701 AACTGAGGCTCAGAGAAGGAAGG - Intergenic
1173850740 20:46216303-46216325 TACCCAGGCTCAGAGGAGGAGGG + Intronic
1174524137 20:51157794-51157816 CACTGAGGCTCAGAGAGGGAGGG + Intergenic
1175244295 20:57572372-57572394 GAAACAGGCTCAGAGATGAAGGG - Intergenic
1175248979 20:57597520-57597542 AACTGAGGCTCAGAGGTGGCAGG + Intergenic
1175333908 20:58182693-58182715 AACTGAGGCTCAGAGATGTAAGG - Intergenic
1175359826 20:58400268-58400290 TTCTCAAGCTTAGAGCTGGAAGG - Intronic
1175601894 20:60281137-60281159 GTCTCAGGCTCACAGCTGCCTGG - Intergenic
1175644339 20:60658392-60658414 AACCCAGGCTTAGGGCTGGATGG + Intergenic
1175771990 20:61629805-61629827 GACTCAGGCTCCAGGCTGCAGGG - Intronic
1175808759 20:61846110-61846132 GAAGCAGGGTCGGAGCTGGATGG + Intronic
1175912698 20:62412374-62412396 GACTGAGGCTCAGATTTGGAAGG + Intronic
1176022094 20:62967157-62967179 GGGTCAGGCTCAGACTTGGAGGG - Intronic
1176105451 20:63383801-63383823 GACTCAGGCCCAGCACTGCAAGG - Intergenic
1178370445 21:32022636-32022658 GACTCAGGCTCAGGGCTGCATGG + Intronic
1179879758 21:44288495-44288517 GACCCAGGCTCCAAGATGGAAGG + Intronic
1181235886 22:21447415-21447437 GACCCAGGCTCAGCCCCGGAGGG - Exonic
1181667605 22:24408990-24409012 AACCCAGGCTCAGAGCTGCAAGG - Intronic
1181785720 22:25225250-25225272 AACTGAGGCTCAGAGGGGGAAGG - Intronic
1181960473 22:26618684-26618706 CACACAGGCCCAGAGCTGGCTGG - Intergenic
1181981444 22:26769600-26769622 GACCGAGGCTCAGAGCAGGGTGG + Intergenic
1182068653 22:27447743-27447765 GACTGAGGCTCAGAGAAGAATGG - Intergenic
1182415840 22:30221060-30221082 CTCTCAGCCTCAGAGATGGAAGG - Intergenic
1182564257 22:31185501-31185523 GGCACAGTCTAAGAGCTGGAGGG + Intronic
1182805783 22:33068922-33068944 GGATCAGCATCAGAGCTGGAGGG + Intergenic
1182812715 22:33131271-33131293 GACTCAGGGACAGAGAGGGATGG - Intergenic
1183057966 22:35318664-35318686 GACTCGGGCTTATTGCTGGAAGG - Intronic
1183069035 22:35383364-35383386 CACTGAGGCTCAGAGAGGGAAGG + Intronic
1183109473 22:35638416-35638438 AACGCAGGCTCAGAGCAGAATGG + Intergenic
1183525149 22:38318176-38318198 AACCCAAGCTCAGAGCTGGGAGG - Intronic
1183709340 22:39493255-39493277 GACGGAGGCCCAGAGATGGAAGG + Intergenic
1184517080 22:44969277-44969299 GCCTCAGTCTAAGAGCTTGAGGG - Intronic
1184674081 22:46030908-46030930 CGCTCAGCCTCAGAGCTGGGAGG + Intergenic
949521095 3:4854710-4854732 GACACAGGAACATAGCTGGATGG - Intronic
950267116 3:11582371-11582393 GTCTCAGGCACAAAACTGGATGG + Intronic
951028010 3:17849786-17849808 GACTCAGGGATAGAGCTGGTTGG + Intronic
952400557 3:32959542-32959564 GTCTCAAGCCCAGAGCAGGATGG - Intergenic
955083961 3:55684094-55684116 GACACAGACTCAGAGCTGGGTGG - Intronic
955320323 3:57969881-57969903 GAGTCAGCCTCTGACCTGGATGG - Intergenic
958685327 3:97386156-97386178 TTCTCAGGCTCATAGGTGGAAGG - Intronic
960595515 3:119404417-119404439 CCCTCAGTCTCAGATCTGGATGG - Intronic
960973527 3:123155717-123155739 GACTGAGTCTCAGGGCTGGGAGG - Intronic
961066476 3:123881217-123881239 CACTCTGGCTCACTGCTGGACGG + Intronic
961426459 3:126852108-126852130 GCCTCATGCTCTGAGCTGGAAGG - Intronic
961637619 3:128343052-128343074 GGCTCAGGCTCCTAGCAGGAGGG + Intronic
961811098 3:129522261-129522283 ACCTCAGAGTCAGAGCTGGAGGG - Intergenic
961975315 3:131018304-131018326 GTGCCAGGCTCAGTGCTGGAGGG - Intronic
962985912 3:140535748-140535770 AACTGAGGCTCAGAGATGAAGGG + Intronic
966086797 3:176078202-176078224 GACTCTGGGCCAGAGCTGGCGGG + Intergenic
966906930 3:184533023-184533045 GGATAGGGCTCAGAGCTGGATGG - Intronic
967890205 3:194359426-194359448 GACCCAGGCCCAGAGCGGGCTGG - Exonic
968227133 3:196979830-196979852 GCCTCAGGCCCGGAGCTGTAGGG - Intergenic
969180618 4:5437809-5437831 TACACAGGTTTAGAGCTGGAAGG - Intronic
969394293 4:6910328-6910350 GACTGAGGGTCCGAGGTGGAAGG - Intronic
969477689 4:7430869-7430891 GCCTCAGTCTCAGTGCTGAATGG + Intronic
969674967 4:8609624-8609646 GTCTCAGCCTCAGAGCTGGCAGG + Intronic
969701277 4:8769165-8769187 AAGTCAGGGACAGAGCTGGATGG + Intergenic
969867484 4:10085151-10085173 GTCTCAGGCTCAGATATGGAGGG - Intronic
970317278 4:14841537-14841559 TTCACAGGCTCACAGCTGGAGGG - Intergenic
970654673 4:18218044-18218066 GAAGCAGGCTCAGAGCTCTAGGG - Intergenic
971117477 4:23664807-23664829 TTCACAGGCTCACAGCTGGAGGG + Intergenic
971274227 4:25180539-25180561 AACTGAGGCTCAGAGAGGGAAGG + Intronic
972180676 4:36461453-36461475 GACTCCAGCTCAGAGCTTAATGG - Intergenic
972331721 4:38070016-38070038 GGAGCAGGGTCAGAGCTGGAGGG + Intronic
974681824 4:65174359-65174381 GACTGATGCTCTGAGCTGCAGGG + Intergenic
974742163 4:66021292-66021314 TTCACAGGCTCAGAGGTGGAAGG - Intergenic
974754640 4:66187312-66187334 GACTCAGGTTCCAGGCTGGATGG - Intergenic
976901917 4:90188714-90188736 GCATCTGACTCAGAGCTGGATGG - Intronic
977021584 4:91767014-91767036 GCCTTAGGCCCAGAGCTGCAGGG - Intergenic
978240817 4:106514276-106514298 TACTGAGGCTCAGAGCTGATGGG + Intergenic
979108279 4:116715844-116715866 GACTCAGCCTCATGCCTGGATGG - Intergenic
981205491 4:142035028-142035050 GACACAGACACAGACCTGGAGGG - Intronic
981372113 4:143970320-143970342 GACTCTGGCTCAAAGGGGGAGGG + Intergenic
981516743 4:145618694-145618716 GACTCGGGCTCACTGCTGCAGGG - Exonic
982104891 4:152003191-152003213 AGCTGAGGCTCAGAGCTGGAGGG + Intergenic
983787997 4:171759059-171759081 TCCTCAGGCTCAGACCTTGACGG - Intergenic
984000542 4:174236163-174236185 GACTAAGGGTCAGATCTGGAAGG + Intergenic
984635199 4:182102708-182102730 GAGGCAGGCTCAGACCTAGATGG - Intergenic
985142943 4:186861899-186861921 GGCTCAGCCTCAGAGGTGGAAGG - Intergenic
986308435 5:6532821-6532843 GAATAAAGCTCAGAGCAGGAGGG - Intergenic
989315397 5:40072047-40072069 CTCACAGGCTCACAGCTGGAGGG + Intergenic
991007756 5:61846525-61846547 TTCACAGGCTCAGAGCTGGAGGG + Intergenic
991547238 5:67795972-67795994 TTCACAGGCTCACAGCTGGAGGG + Intergenic
993606054 5:89991894-89991916 GACTCAGCAGCAGAGATGGAAGG - Intergenic
994144940 5:96384230-96384252 CACTGAGTCTCAGAACTGGAAGG - Intergenic
997424314 5:133792900-133792922 AACTCGGGCTCAGAGCAGGAGGG + Intergenic
997724812 5:136111792-136111814 GTCCCAGGCTCAGAGCTTGGTGG + Intergenic
998133919 5:139664848-139664870 CACTGAGGCTCAGAGCTGAGTGG - Intronic
998545730 5:143025837-143025859 GACTGTGGCTGAGAGCTGGTAGG + Intronic
999136018 5:149319776-149319798 GACTCAGCCTCTGAGAGGGATGG - Intronic
1000047372 5:157532781-157532803 TACTCAGGATTAGAGCTGGGAGG - Intronic
1001217337 5:169868143-169868165 GTGTCAGGCCCAGAGCAGGATGG - Intronic
1001545720 5:172569480-172569502 AACTGAGGCTCAGACCTGGATGG + Intergenic
1001672215 5:173483229-173483251 GACCAAGGTTTAGAGCTGGAAGG - Intergenic
1001677792 5:173532893-173532915 TACTGAGGATCAGAGCTGGCAGG + Intergenic
1001773501 5:174312349-174312371 GACTCAGGCTCTGAGCAGGCTGG - Intergenic
1001868704 5:175131277-175131299 GTCCCAGGCTCAGAGAGGGAGGG - Intergenic
1002101700 5:176861095-176861117 AACTGAGGCACAGAGCTGGCAGG - Intronic
1002819714 6:713329-713351 GGCTCAGTGTCAGAGATGGAAGG + Intergenic
1003466536 6:6384941-6384963 GACTGAGACTCTGAGCTGGCTGG - Intergenic
1003999947 6:11588397-11588419 GACTAAGGCTCAGAACTACATGG - Intergenic
1005533052 6:26727894-26727916 GAGACAGCCTCAGACCTGGAAGG - Intergenic
1005535406 6:26750120-26750142 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1005537742 6:26773770-26773792 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1005871206 6:29975404-29975426 GCCTCAGCGGCAGAGCTGGAAGG + Intergenic
1007756011 6:44100145-44100167 GATTTAGGCTCAGAGCTCAAGGG - Intergenic
1009006440 6:57793753-57793775 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1009008613 6:57816183-57816205 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1010566434 6:77420108-77420130 CTCACAGGCTCAAAGCTGGAGGG + Intergenic
1010794824 6:80106725-80106747 TACTCAGGCTCAGGGCGGCAGGG + Exonic
1011018247 6:82782354-82782376 TTCACAGGCTCACAGCTGGAGGG + Intergenic
1011551825 6:88537330-88537352 GACTCAACCTCAGAACAGGATGG - Intergenic
1011935426 6:92770638-92770660 TTCACAGGCTCACAGCTGGAGGG + Intergenic
1012542375 6:100376278-100376300 GACTCAGGCTCAGGGGAGGAGGG - Intergenic
1013463729 6:110399666-110399688 GACGCAGGCTCCGGGCTGCAGGG + Intronic
1014318032 6:119891384-119891406 TCTTCAGGCTCACAGCTGGAGGG + Intergenic
1017743509 6:157427136-157427158 GGCTCAGGCGTAGACCTGGAGGG + Intronic
1018034607 6:159871548-159871570 GAAGCAGGCTCAGAGCTGTTTGG + Intergenic
1018765881 6:166932388-166932410 GGCTCAGGGGCAGAGCAGGAGGG - Intronic
1019597388 7:1864421-1864443 GACTGGGGCTCAGGGCTGGATGG + Intronic
1020014720 7:4824295-4824317 GAGCCAGGCTCAAGGCTGGACGG + Intronic
1021729472 7:23582412-23582434 GACTCAGGCCAAGAGGTAGATGG + Intergenic
1022243686 7:28536418-28536440 CACTGAGCTTCAGAGCTGGAAGG - Intronic
1022479051 7:30731192-30731214 GACTGAGGCTCAGAGAGGGAGGG - Intronic
1023294663 7:38702305-38702327 GTCACAGTCTCAGAGATGGACGG + Intergenic
1026039966 7:66859938-66859960 GACTCCCACTGAGAGCTGGAGGG - Intergenic
1026461632 7:70619920-70619942 GTCCCAGCCACAGAGCTGGAAGG + Intronic
1026978865 7:74515155-74515177 GACTGAGGCTCAGAGAGAGAAGG + Intronic
1027663510 7:81016432-81016454 TTCACAGGCTCACAGCTGGAGGG - Intergenic
1029374802 7:100171231-100171253 GGCTCAGGCTCAGGGATGCAGGG + Intronic
1029969731 7:104777423-104777445 GCATCAGGGTCAGAGCTGGTGGG - Intronic
1030576074 7:111287685-111287707 GATTCGGGCCCAGAGTTGGAGGG + Intronic
1030886483 7:114944790-114944812 GACTCTGGCTCAGAGCTTCATGG + Intronic
1031480211 7:122269302-122269324 GCCTCAGCCTGGGAGCTGGAAGG - Intergenic
1032410256 7:131689344-131689366 GCCTCAGCCACAGAGCTGCAGGG + Intergenic
1032473868 7:132199188-132199210 GACTCAGGATCGGAGGAGGAGGG - Intronic
1032476105 7:132212433-132212455 GACTTAGGCTCAGAGGGAGAAGG + Intronic
1033447606 7:141436480-141436502 GGCACAGGCTCAGATGTGGATGG + Intronic
1034267803 7:149789658-149789680 GACTCCGTCACACAGCTGGATGG - Intergenic
1034822566 7:154230495-154230517 GACCCAGGTTCACAGCTGGGAGG - Intronic
1035079566 7:156204705-156204727 GGCTCAGGCACTGAGATGGAGGG - Intergenic
1035290860 7:157837603-157837625 GACTCAGGCACAGAGCAAGAGGG - Intronic
1035295336 7:157864241-157864263 GACCCAGTCACAGATCTGGATGG - Intronic
1038103104 8:24401671-24401693 GCCTAAGTCACAGAGCTGGAAGG - Intronic
1039473487 8:37827505-37827527 GCCACAGACTCAGGGCTGGAAGG + Intronic
1039506888 8:38058714-38058736 TTCACAGGCTCACAGCTGGAAGG - Intronic
1039892148 8:41693025-41693047 GCCTCAGCCTCAGGCCTGGACGG + Intronic
1040724704 8:50368932-50368954 TTCACAGGCTCAGCGCTGGAGGG + Intronic
1041578247 8:59424840-59424862 GACTCTGGCTTAGAGTTGAAGGG + Intergenic
1041971535 8:63748482-63748504 GAGTCAGTCACAGAGTTGGATGG - Intergenic
1044813389 8:96086543-96086565 GACTCAGGTACAGAGATTGAGGG + Intergenic
1045678227 8:104631862-104631884 GACACAGTCTCAGAGCTAGAAGG - Intronic
1048063451 8:130944184-130944206 AACTGAGGCTCAGAGATGCAAGG + Intronic
1048468553 8:134687135-134687157 CACTGAGCATCAGAGCTGGAAGG - Intronic
1048857179 8:138695224-138695246 GTGCCAGGCTCTGAGCTGGAGGG - Intronic
1049102701 8:140590678-140590700 GGCTCCTGCTCAGGGCTGGAGGG - Intronic
1049239265 8:141528703-141528725 TCCTCTGGCTCAGAGCTGCATGG + Intergenic
1049789134 8:144465142-144465164 GACTCAGGGTCTAAGCTGGGGGG + Intronic
1050528875 9:6569965-6569987 GACTCAGGCTCATGGCCGGGGGG + Intronic
1050619648 9:7439517-7439539 GACACAGGCACACTGCTGGATGG + Intergenic
1052706856 9:32004468-32004490 AACTCAGGATAAGAGTTGGAGGG + Intergenic
1053123178 9:35560921-35560943 GACTCAGGCTCTGCCCAGGATGG - Intronic
1053200101 9:36146553-36146575 TTCACAGGCTCACAGCTGGAAGG - Intronic
1053576790 9:39362555-39362577 TACACATGCACAGAGCTGGAAGG - Intergenic
1053841303 9:42190480-42190502 TACACATGCACAGAGCTGGAAGG - Intergenic
1054098360 9:60921246-60921268 TACACATGCACAGAGCTGGAAGG - Intergenic
1054119761 9:61196876-61196898 TACACATGCACAGAGCTGGAAGG - Intergenic
1054587993 9:66985686-66985708 TACACATGCACAGAGCTGGAAGG + Intergenic
1055986014 9:82056877-82056899 TACACATGCACAGAGCTGGAAGG + Intergenic
1056233457 9:84569709-84569731 GAGTAAGGGTCAGAGCTGGTGGG + Intergenic
1056585322 9:87924254-87924276 TACACATGCACAGAGCTGGAAGG - Intergenic
1056611559 9:88128686-88128708 TACACATGCACAGAGCTGGAAGG + Intergenic
1056872907 9:90301731-90301753 GACTAAGGCTCAGATTTTGAAGG - Intergenic
1057280638 9:93708706-93708728 GCCTCAGGAACAGTGCTGGATGG + Intergenic
1057515157 9:95714384-95714406 GCCTCAGGCGCAGAGCTGCCTGG - Intergenic
1057792420 9:98132994-98133016 GGCTCAGGCTCAGAGGAGCAAGG - Intronic
1057858437 9:98620869-98620891 AACTGAGACTCAGAGGTGGAAGG - Intronic
1057969898 9:99544927-99544949 TTCACAGGCTCACAGCTGGAGGG - Intergenic
1059458115 9:114412483-114412505 GACTGAAGATCAGAGCGGGAAGG + Intronic
1059766592 9:117389431-117389453 GACTCAGGCCACCAGCTGGAAGG + Intronic
1061042948 9:128150165-128150187 GCCACAGGGACAGAGCTGGAGGG + Intronic
1061176362 9:128999846-128999868 GAGTCAGGCACAGAGCTGGCGGG - Intronic
1062047989 9:134433207-134433229 GACTCAGCCTCCGAGCTGGCAGG - Intronic
1062078382 9:134604905-134604927 TTCACAGGCTCACAGCTGGAGGG - Intergenic
1062157535 9:135061483-135061505 GATTCAGGAGAAGAGCTGGAGGG - Intergenic
1189226451 X:39417204-39417226 AAATCAGGTTCAGAGGTGGACGG + Intergenic
1190209249 X:48431641-48431663 TAATCAGGCTCAGAACTAGATGG + Intergenic
1191739598 X:64422869-64422891 GACTGAGGCTCACAACTGGTAGG + Intergenic
1191868327 X:65724011-65724033 AATTCAGGCTCAGTGCTGGGGGG - Intronic
1191875165 X:65788240-65788262 GACCTGGGCTCAGAGCTGGCAGG - Intergenic
1192146275 X:68685002-68685024 AACTCAGTGTCAGAGCTAGAAGG - Intronic
1192230622 X:69262394-69262416 GCCGCAGGCTCAGAGCCAGAAGG - Intergenic
1194119052 X:89937955-89937977 TCCTCAGGCTCAGACCTTGACGG + Intergenic
1194684077 X:96890255-96890277 CACAGAGGCTTAGAGCTGGAAGG - Intronic
1195068976 X:101261587-101261609 GATTCAGCCTGAGAGCTAGAAGG - Exonic
1196020552 X:110986567-110986589 GATTCAGGCTCTGAGCATGAAGG - Intronic
1196734507 X:118972771-118972793 CACTCAAGGTTAGAGCTGGAGGG + Intergenic
1197700804 X:129598102-129598124 GACTCAGCCTGAGAGGTGGGTGG - Intergenic
1200124350 X:153806243-153806265 TCCTGGGGCTCAGAGCTGGAAGG - Intronic
1200216143 X:154369010-154369032 GTCTCAGGCTCAAGGCAGGATGG + Intronic
1200471928 Y:3595515-3595537 TCCTCAGGCTCAGACCTTGACGG + Intergenic
1201861294 Y:18600108-18600130 AACTCAAGGTCAGAACTGGAAGG + Intergenic
1201872029 Y:18720272-18720294 AACTCAAGGTCAGAACTGGAAGG - Intergenic