ID: 1144991798

View in Genome Browser
Species Human (GRCh38)
Location 17:19238086-19238108
Sequence GCCTGGTCCCCAAGGACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144991798_1144991812 15 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991812 17:19238124-19238146 CCCCACTCCCACGGAACAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 158
1144991798_1144991821 23 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991821 17:19238132-19238154 CCACGGAACAGCGGGGACGGGGG 0: 1
1: 0
2: 0
3: 13
4: 91
1144991798_1144991822 26 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991822 17:19238135-19238157 CGGAACAGCGGGGACGGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 245
1144991798_1144991819 22 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991819 17:19238131-19238153 CCCACGGAACAGCGGGGACGGGG 0: 1
1: 0
2: 0
3: 8
4: 112
1144991798_1144991816 20 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991816 17:19238129-19238151 CTCCCACGGAACAGCGGGGACGG 0: 1
1: 0
2: 0
3: 12
4: 93
1144991798_1144991810 14 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991810 17:19238123-19238145 CCCCCACTCCCACGGAACAGCGG 0: 1
1: 0
2: 1
3: 13
4: 191
1144991798_1144991817 21 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991817 17:19238130-19238152 TCCCACGGAACAGCGGGGACGGG 0: 1
1: 0
2: 0
3: 13
4: 86
1144991798_1144991805 6 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991805 17:19238115-19238137 CTCCCCAGCCCCCACTCCCACGG 0: 1
1: 2
2: 17
3: 122
4: 971
1144991798_1144991814 16 Left 1144991798 17:19238086-19238108 CCTTCCGTCCTTGGGGACCAGGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1144991814 17:19238125-19238147 CCCACTCCCACGGAACAGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144991798 Original CRISPR GCCTGGTCCCCAAGGACGGA AGG (reversed) Intronic
900101776 1:964974-964996 ACCTGGTGGCCATGGACGGATGG + Exonic
900568888 1:3348735-3348757 CCCCGGTCCCCAAGGGCAGAGGG - Intronic
900996421 1:6125658-6125680 TCCTGATCCCCAAGGACAGCGGG + Intronic
904833341 1:33319758-33319780 GCCTGGTGCCCCAGGAGGCAGGG - Intronic
906126807 1:43431941-43431963 GCCTGGGGCCCAGGGAAGGACGG - Intronic
907073470 1:51558330-51558352 GTCTGGTCCCCAAGCAAGGAAGG - Intergenic
911736165 1:101338742-101338764 GTCTGGTCCCCAGGCAAGGAGGG - Intergenic
914001056 1:143694751-143694773 GTCTGATCCCCAAGAAAGGAAGG - Intergenic
914511022 1:148332123-148332145 GTCTGATCCCCAAGAAAGGAAGG - Intergenic
914857674 1:151364484-151364506 GCCAGGTCCCCAAGGAAGTGAGG + Exonic
919290486 1:195623782-195623804 GCCTGGATCCCAAGGAGGGATGG + Intergenic
919827954 1:201517361-201517383 GTCTGGTCCCCAAGCAAGAAGGG - Intergenic
920963472 1:210683767-210683789 GCCTGGGCCCCAAGGGGGGCGGG - Exonic
922348908 1:224719971-224719993 GCCTGGGCCACAGGGAGGGAGGG + Intronic
922352786 1:224748010-224748032 GCCTGGTCCCAAGGGAAGCAGGG + Intergenic
1062788883 10:288774-288796 GCCTGGTCCTCAAGCACCGACGG + Intronic
1062804419 10:406667-406689 GACTGGTCCCCAAGCAAGAAAGG - Intronic
1062829551 10:596652-596674 GGCTGCACCCCAAGGAAGGAAGG + Intronic
1063262173 10:4401807-4401829 GCCTGGCCCCCAAACACAGATGG - Intergenic
1068522841 10:58096032-58096054 GTCTTGTCCCCAAGCAAGGAGGG - Intergenic
1070793429 10:79203166-79203188 TCCTGGCCCTCAAGGAGGGAAGG - Intronic
1071759401 10:88583377-88583399 GTTTGCTCCTCAAGGACGGAGGG - Intronic
1072767380 10:98106506-98106528 GTCTGATCCCCAAGGAAGGAGGG - Intergenic
1072903718 10:99431340-99431362 GCCTGGTCCTCAAGGACCTCGGG + Intergenic
1073212844 10:101818623-101818645 GCCTGGCACCCTGGGACGGACGG + Intergenic
1076002998 10:126927310-126927332 GCCTAGTCCCTCTGGACGGAAGG - Intronic
1077288585 11:1778482-1778504 GCCTGTTCCCCAGGGTGGGACGG + Intergenic
1077297413 11:1832594-1832616 GCCGGGTCCCGAGGGGCGGACGG + Intronic
1079094715 11:17502855-17502877 GGCTGGTCCCCATGGAAGGTGGG + Intronic
1080645412 11:34184472-34184494 GCCTGATTCCTAAGGACAGATGG - Intronic
1083876488 11:65526707-65526729 GCCTGGTGCCCAAGGCAGGCTGG + Intronic
1088411639 11:109540613-109540635 GTCTGGTCCCTAAGCAAGGAGGG - Intergenic
1089341273 11:117759455-117759477 GCCTCGTCCCCAGGGCTGGAAGG + Intronic
1090462174 11:126901377-126901399 CCCTGCTCCCCAAGGAAGAAGGG - Intronic
1090558143 11:127898763-127898785 GCCTGGTCCCCCAGCACTGCCGG - Intergenic
1092365191 12:7871691-7871713 GGCTGCTCCCCAAGGAGGAAGGG + Intronic
1094022939 12:25933696-25933718 GCCTGGTCTCCAGTGACTGATGG - Intergenic
1096533447 12:52256288-52256310 GGCTGTTCCCCAAGGAGGGCTGG - Intronic
1098532289 12:71554529-71554551 GCCTGGTCCCAAGGCAAGGAGGG + Intronic
1103215783 12:119200319-119200341 GACTGGTCCCCAAGCAAGAAGGG + Intronic
1103408534 12:120693723-120693745 GCCTGGTTCCCCAAGAGGGAGGG - Intronic
1111597200 13:90427555-90427577 TCCTGGTCCCCTAGGGCGCAGGG - Intergenic
1115921400 14:38378102-38378124 GCCTGGTCTCCAGGGAGGCAAGG - Intergenic
1120365386 14:83561754-83561776 GCCTGAGCCCCTAGGAAGGAGGG + Intergenic
1121886158 14:97544730-97544752 ACCTGGTCACCAGGCACGGAAGG + Intergenic
1122383415 14:101326992-101327014 GCCTGGTCCCTAAAGCAGGAAGG - Intergenic
1122777818 14:104130410-104130432 GCCTGGACCCCAGGGTCTGAGGG + Intergenic
1123795371 15:23765533-23765555 GTCTGGTCCCCAGGCAAGGAAGG + Intergenic
1124363316 15:29054398-29054420 TCATGGGCCTCAAGGACGGAGGG - Exonic
1125782648 15:42283871-42283893 GCCTGTTCCCCAAGGACAACTGG - Intronic
1125818147 15:42604006-42604028 GTCTGGTCCCCATGCAAGGAGGG + Intronic
1127259039 15:57314523-57314545 GCCAGGACCCCAGGGAAGGAGGG - Intergenic
1132178043 15:99731509-99731531 CCCTGGCCCCCAAAGAGGGAGGG - Intronic
1132326436 15:100973854-100973876 GCGCGGTCCCGCAGGACGGAAGG + Exonic
1132600634 16:771058-771080 CCCTGTTCCCCCAGGACAGAGGG - Intronic
1132687325 16:1167848-1167870 GCCCGGGCCCCGCGGACGGACGG - Intronic
1133464202 16:6014552-6014574 GCCATGTGCCCAAGGACTGAGGG + Intergenic
1136117423 16:28103591-28103613 GCCTGGTCCCCACTGAGGGCTGG - Intronic
1136386098 16:29926801-29926823 GCCCGGGCACCAAGGATGGAAGG + Exonic
1136609046 16:31355296-31355318 GCCTGGACCCCAATGAAGTAGGG + Intronic
1137452487 16:48589962-48589984 GACTGGTCCCCAAGCAAGAAGGG - Intronic
1138659655 16:58509639-58509661 CCCTGGACCCCCAGCACGGAAGG - Intronic
1139066673 16:63324263-63324285 GTCTGATCCCCAAGCAAGGAGGG - Intergenic
1139326931 16:66160009-66160031 GCCTAGTCCCCAAGGGGGTAGGG - Intergenic
1142515830 17:428110-428132 GTGTGGTCCCCAAGCAAGGAAGG - Intergenic
1144991798 17:19238086-19238108 GCCTGGTCCCCAAGGACGGAAGG - Intronic
1147456694 17:40542446-40542468 GCCTGGGCCCCAGGGAGGGCGGG - Intergenic
1148767760 17:50049224-50049246 GCCTTGTGCCCAAGGAGAGAAGG + Intergenic
1148778351 17:50108426-50108448 CCCTGGTCCCCAAGGTCAAAGGG - Intronic
1148894424 17:50831622-50831644 GCCTGGGCCCCGCGGAGGGAGGG + Intergenic
1151813973 17:76462004-76462026 GCATTGTCCCCAAGGAAGGAGGG - Intronic
1155714047 18:28918054-28918076 GCCAGGTCCCCAAGCAAGGAGGG - Intergenic
1156315872 18:35968193-35968215 GCCTGGTCCCCAGGCAAGAACGG + Intergenic
1161346208 19:3769992-3770014 GCCAGGTCCCCAAAGTCGCACGG - Exonic
1162495311 19:11020067-11020089 GCCAGGGCCCCAGGGAGGGACGG - Intronic
1162577082 19:11505457-11505479 GCCTGGCCCCGAGGGAGGGAGGG - Intronic
1162788450 19:13050928-13050950 GGCTGGTCTGGAAGGACGGAAGG - Intronic
1164257905 19:23545291-23545313 GCCTGTTCCCCAATGACTGGGGG - Intronic
1166373874 19:42316295-42316317 CCCTGCTCCCCAAGGACCCAGGG - Intronic
1166885847 19:45960655-45960677 GGCTGGCCCCCAAGCCCGGAGGG + Intronic
1167658361 19:50780957-50780979 GCCTGGTGCGCATGGTCGGAAGG - Intergenic
1167689491 19:50976077-50976099 ACCTGCTCCCCAAGAAGGGAGGG - Intergenic
1168280397 19:55302482-55302504 GCCTGGACCCCTCGGTCGGAGGG + Intronic
1168676108 19:58279080-58279102 GCATGGACCCCGAGGACGAAGGG + Exonic
926999382 2:18776865-18776887 GCCAGGTCCCTAAGGACTGCAGG + Intergenic
927920873 2:26970976-26970998 GCCGGGCCGCCAAGGCCGGAGGG - Intronic
929075434 2:38076001-38076023 GCCAGGTCCCCAAGGGCAGCGGG - Exonic
935753876 2:106262174-106262196 GCTGGGTCCCGAAGGATGGAAGG + Intergenic
936271027 2:111049089-111049111 GCCATGTCACCAAGGAAGGACGG + Intronic
937917770 2:127107261-127107283 GCCAGGTCCGCGAGGAGGGAGGG + Exonic
938209875 2:129458618-129458640 ACATGGTCCCCAGGGAGGGAGGG + Intergenic
939134146 2:138273938-138273960 GTCTGATCCCCAAGGAAGGAAGG - Intergenic
941404253 2:165069391-165069413 GACTGGTCCCCAGGCAAGGAGGG + Intergenic
942341943 2:174958103-174958125 GCCTGGGCACCAAGGAAGGAAGG + Intronic
942539368 2:176999519-176999541 TCCTGGGCCCCAAGGAGGGAAGG + Intergenic
943524487 2:188999362-188999384 CCCTGGTCCCGAAGGAGGAAAGG + Exonic
947226206 2:227842862-227842884 GTCTGGTCCCCAAGCAAGAAAGG - Intergenic
949035100 2:241812579-241812601 GGCTGGTCCCCCAAGACAGAGGG + Intronic
1168972711 20:1941718-1941740 GCCTGGTCCTCATGGAGGAAGGG - Intergenic
1175779555 20:61673628-61673650 GGCTGGTCACCCAGGAAGGATGG - Intronic
1178373600 21:32048511-32048533 ACCTAGGCCCCAAGGAAGGAGGG + Intergenic
1178422774 21:32455568-32455590 GCCTGGGATCCAAGGATGGATGG - Intronic
1180971113 22:19816183-19816205 GCCTCGTCCCCAGGGAAGGAAGG - Intronic
1183864392 22:40692787-40692809 GCCTGGTCTCCAGGGTCGGTGGG - Intergenic
1184514597 22:44954295-44954317 GCTGGGTCCCCAAAGAGGGAGGG - Intronic
1184694803 22:46133344-46133366 GCCTGGCCCCCAGGGAGGGATGG + Intergenic
1184960831 22:47927302-47927324 TTCTGGTCCCCAAGCAAGGAGGG + Intergenic
1185273274 22:49938264-49938286 GCCTGGGCCCCACGGTCAGACGG - Intergenic
950132978 3:10560312-10560334 GCCTGTCCTCCCAGGACGGATGG + Intronic
950914148 3:16626712-16626734 GGCTGCTCACCAAGGAAGGAGGG + Intronic
953303877 3:41807966-41807988 GGCCTGTCCCCAAGGGCGGATGG - Intronic
953745436 3:45570463-45570485 GTCTGGTCCCCAAGCAAGGAGGG - Intronic
953981933 3:47417662-47417684 GGCTGGTCCCCGAAGAGGGAAGG + Exonic
955126162 3:56114878-56114900 ATCTGGTCCCCAAGCAAGGAAGG - Intronic
958758329 3:98276189-98276211 GTTTGGTTCCCAAGGAAGGAGGG - Intergenic
961558734 3:127714370-127714392 GCTGGCTGCCCAAGGACGGAAGG + Intronic
961762684 3:129183453-129183475 GCCTCGGCCCCAAGGGCGCACGG + Intronic
961781472 3:129323255-129323277 GCCTGATCCCCAGGGAGGGGTGG - Intergenic
963717758 3:148822966-148822988 GTCTGGTCCCCAGGCAAGGAGGG + Intronic
968090388 3:195895385-195895407 GCCCGGCCCCCCAGGACGCAGGG - Exonic
969064446 4:4467236-4467258 GCCTTGTCCCCAAGCAAGAAGGG + Intronic
969249799 4:5959602-5959624 GCGTGGACACCAAGGACAGAGGG + Exonic
972035573 4:34515134-34515156 GCCTGGTCCCTAAGCATGAAGGG - Intergenic
972397869 4:38672846-38672868 GCCTGGCCCCCAAGGCAGGAGGG + Intronic
972819477 4:42683231-42683253 GACTGGTCCCCAGGGAAGAAGGG + Intergenic
973774957 4:54233754-54233776 GCCTGCCCCCCAAGAACGCACGG - Intronic
974703943 4:65487380-65487402 GTCTGGTCCCTAAGCAAGGAGGG - Intronic
975342512 4:73258247-73258269 GCCTGGTTTCAAAGGAAGGAGGG - Intronic
976844610 4:89473724-89473746 GCCTGGTCCCCATGATAGGAGGG - Intergenic
980085783 4:128388344-128388366 GGCTGGTCCCTAAGGAGGAATGG - Intergenic
983511198 4:168611100-168611122 GCCTGGTCCCCAGTGACCAAGGG - Intronic
983934868 4:173494628-173494650 TCCTGGTGCCCAAGGAGGAAAGG - Intergenic
987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG + Intronic
992472263 5:77069672-77069694 GTCTGGTCCCCAAGCAAGAAGGG + Intergenic
993954831 5:94219388-94219410 GCCTGGTCCCCAAGAGCCCATGG + Intronic
997530826 5:134580167-134580189 GACTGGCCCCGAAGGAAGGAAGG - Exonic
998957561 5:147453433-147453455 GCCTGGTCCCCGGGGAGGGACGG - Intronic
999202488 5:149826257-149826279 GCCTGGACCCCAGGGTCTGAGGG + Intronic
999306613 5:150523679-150523701 GCCTGGTCCCCAAAGACTGTGGG - Intronic
999529097 5:152442597-152442619 GTCTGGTCCCCAAGCAAGGACGG - Intergenic
1001666621 5:173438475-173438497 CCCTGCTCACCAAGGACAGACGG + Intergenic
1002600738 5:180352929-180352951 GCCCGGTCCCCACGGAGGGGAGG - Intronic
1005336002 6:24796915-24796937 GTCTGGTCCCCAAGCAAGGAGGG + Intergenic
1007539437 6:42627431-42627453 GTCTGGTTCCCAAGCAAGGAGGG + Intronic
1007702476 6:43772976-43772998 TCCTGGGCCCCAAGGAGGAAAGG - Intronic
1012483786 6:99697667-99697689 GCATGGTTACCAAGGACTGAGGG - Intergenic
1015367761 6:132416087-132416109 GTCTGGTCCCTAAGCAAGGAGGG - Intergenic
1018952943 6:168391006-168391028 GCTTGGTCCCTCAGGAAGGAGGG - Intergenic
1019389005 7:774732-774754 GCCTGGGCCCCAAGGACGTGGGG - Intronic
1019419641 7:945123-945145 GGCTGGTCCCCAAGGCAGAAGGG + Intronic
1019504211 7:1382759-1382781 GCCTGGGACCCCAGGACGGCGGG + Intergenic
1020086793 7:5314953-5314975 GCCTGGTCCCCAGGGCAGGGCGG - Intronic
1023461867 7:40406396-40406418 GTGTGGTCCCCAAGCAAGGATGG + Intronic
1030755227 7:113279528-113279550 GCCTGGTCCCAAAGGATTTATGG + Intergenic
1031583816 7:123508582-123508604 GCCTGGTACCTAAAGACGAAAGG + Intronic
1032500843 7:132398584-132398606 GCCTGGGCTCCAGGGACGCAGGG + Intronic
1034441292 7:151087176-151087198 GCCTGGTCCTCAAGCGCGCAAGG - Intronic
1035079507 7:156204259-156204281 ACCTGTCCCCCAAGGAGGGAGGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035359953 7:158305093-158305115 GCCTGGACACCAAGGGAGGAGGG + Intronic
1038198575 8:25390685-25390707 GGCTGGTCCCCAGTGATGGAGGG + Intronic
1038328465 8:26589803-26589825 GCCTGCTCTCCAAGTACAGAGGG + Intronic
1041322259 8:56625381-56625403 GTCTGGTCCCCAGGCAAGGAGGG + Intergenic
1042847767 8:73185446-73185468 CCCTGGTTCCCATGGAAGGATGG + Intergenic
1042877413 8:73451908-73451930 GCATGCTGCCCAAGGACTGAAGG + Intronic
1048638871 8:136330647-136330669 GCCTGTTCCCTAAAGAAGGATGG + Intergenic
1048997218 8:139801467-139801489 ACCTGGCCCCCAAGGAGGCATGG + Intronic
1049336624 8:142090035-142090057 TCCTGGTCCCCGGGGATGGAGGG + Intergenic
1049826871 8:144674669-144674691 GCCTGGGCACCATGGACGGCAGG - Intergenic
1053510400 9:38682990-38683012 GCCTGGCCCCCAAGGAGGGGAGG + Intergenic
1059637793 9:116187624-116187646 GCCTGGTCCCCCATGAAGGATGG + Exonic
1062108175 9:134767014-134767036 GCCTGGCCCCCCAGGACAGCAGG + Exonic
1062370485 9:136236255-136236277 GGCTGCTGCCCAAGGACAGAGGG + Intronic
1062488876 9:136794804-136794826 GCCTGGCCCCCAAGAACGAGGGG + Intronic
1062599984 9:137315312-137315334 GCCTGGACACCAAGGTCTGAGGG - Intronic
1189961693 X:46330560-46330582 ATCTGGTCCCCAAGCAAGGAGGG + Intergenic
1191792396 X:64984745-64984767 GCCTGATCCCCAAGCAAGAAGGG + Intronic
1192848153 X:74926128-74926150 GCCTGGGCCCCCAGGAAGGTGGG + Intergenic
1196755026 X:119150478-119150500 ACCTGGGCCCCAGGGACCGAGGG - Exonic