ID: 1144991953

View in Genome Browser
Species Human (GRCh38)
Location 17:19238885-19238907
Sequence TTACATAATGAGAGGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144991953_1144991955 -7 Left 1144991953 17:19238885-19238907 CCAAGCTTCCTCTCATTATGTAA 0: 1
1: 0
2: 0
3: 7
4: 227
Right 1144991955 17:19238901-19238923 TATGTAATATAACGAAGATTTGG 0: 1
1: 0
2: 0
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144991953 Original CRISPR TTACATAATGAGAGGAAGCT TGG (reversed) Intronic
900937808 1:5777839-5777861 TTCCATATTGTGAGGAAGCCAGG - Intergenic
901403282 1:9029164-9029186 TTGCACAATGAGAAGAGGCTGGG - Intergenic
904001914 1:27343447-27343469 TTACCTCAGGAGAGGAAGTTGGG + Intronic
904970072 1:34412610-34412632 CAACATAAAGAGAGGAGGCTGGG - Intergenic
905531604 1:38683799-38683821 TTAAAGAATAAGAAGAAGCTGGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906093600 1:43204230-43204252 TTAAATAATTAAAGGAAGGTAGG - Intronic
908581141 1:65518738-65518760 TTACATAGTGATAGAAAGCTTGG - Intronic
909985447 1:82155693-82155715 TGACAGACTGAGATGAAGCTTGG - Intergenic
910530886 1:88234247-88234269 TTACATAATAAGAGTAGTCTAGG - Intergenic
911887201 1:103318421-103318443 TTATATAGAGAGAGGAAGGTGGG + Intergenic
915846841 1:159275565-159275587 GCACTTAAGGAGAGGAAGCTAGG - Intergenic
916315654 1:163445346-163445368 CTGCATAATGAGAGGCAGCCTGG + Intergenic
916332798 1:163637224-163637246 TTACATAAAGGAAGGAACCTGGG - Intergenic
919541807 1:198856593-198856615 TTAGAAAAGGAGAGGAAGCAAGG + Intergenic
919650391 1:200143468-200143490 TTACAAAAGGAGTGGAAGTTTGG + Intronic
919865988 1:201783345-201783367 TTACAGAGTGAGAGGCAGATAGG - Intronic
920896355 1:210054320-210054342 TTACAGTATGGGAGGAAACTAGG - Intronic
922006037 1:221531606-221531628 TTAAATGATGAAAGGAAGTTAGG + Intergenic
922391843 1:225151708-225151730 TTACATAGTAAAAGGAACCTGGG - Intronic
922915847 1:229257021-229257043 TTACACAAAGAAAGGAAGGTGGG - Intergenic
923093420 1:230756479-230756501 GTAAATAATGATAGGAAGGTAGG + Intronic
924735187 1:246749378-246749400 GTATATAATGAGAGAAAGTTTGG + Intronic
1063490288 10:6457874-6457896 GTACAGAATGAGAAGAAACTGGG - Intronic
1064695076 10:17956806-17956828 TTAGATAATAAGACAAAGCTGGG - Intronic
1066612461 10:37264420-37264442 TTCCATAAGAAGAGGTAGCTAGG + Intronic
1067319116 10:45200232-45200254 TCACATAATTAGAGGGTGCTGGG - Intergenic
1067319805 10:45206718-45206740 TCACATAATTAGAGGGCGCTGGG - Intergenic
1067818802 10:49508034-49508056 TTACATAATGAGAGAGTCCTCGG + Intronic
1068757949 10:60675511-60675533 TTAGGTATTGAGAGGAAGCCAGG - Intronic
1069788663 10:71005633-71005655 TTACTTAGTGAGCGGGAGCTTGG - Intergenic
1070630105 10:78078472-78078494 TTCCATAAAGAGGGGGAGCTTGG - Intergenic
1070780700 10:79135958-79135980 GTACACAATCAGGGGAAGCTGGG + Intronic
1073971894 10:109053138-109053160 TGACACAATAAGAGGAAGGTTGG - Intergenic
1074032289 10:109700840-109700862 TCACAGAATAAGAGGAATCTTGG + Intergenic
1075498423 10:122949410-122949432 CTACATAATGAGATGAAGTGAGG + Intronic
1075701835 10:124474903-124474925 GTACATTCTGAGAGGAAGCCAGG - Intronic
1076074592 10:127523160-127523182 TAAGAAGATGAGAGGAAGCTGGG - Intergenic
1076825294 10:132964204-132964226 TTAAATCCTGACAGGAAGCTTGG - Intergenic
1079951199 11:26807333-26807355 TTACATAAAAAAAGGAAACTTGG - Intergenic
1081832920 11:46129628-46129650 CTACAGAATGAGAGAAAGCAGGG + Intergenic
1082874613 11:57975304-57975326 TTACATGGGGAGAGGATGCTTGG - Intergenic
1085149060 11:74233481-74233503 TTTCCTAATGAGAGGCAGCAGGG + Intronic
1087477301 11:98652186-98652208 TTGAATATTGTGAGGAAGCTTGG + Intergenic
1087659093 11:100964846-100964868 TAAGATAAGGAGAGGAATCTGGG + Intronic
1087913618 11:103781973-103781995 TTGGGGAATGAGAGGAAGCTAGG + Intergenic
1088817210 11:113429646-113429668 TTACATGGTGAGAGCCAGCTAGG - Intronic
1090811096 11:130244237-130244259 TTACCTAATGAGAATAAGCTAGG - Intronic
1090880037 11:130825235-130825257 TTACAGAAAGAGAGAGAGCTGGG - Intergenic
1092087734 12:5777621-5777643 TGGCATAAGGAGAGGAAGATGGG - Intronic
1094421537 12:30276764-30276786 TAACATGAGGAGATGAAGCTTGG - Intergenic
1095742053 12:45618288-45618310 TTTCAGAATGAAAGGAATCTCGG + Intergenic
1096114219 12:49045827-49045849 TAAAATAAGGAGATGAAGCTAGG + Intronic
1098452567 12:70636340-70636362 TTGGAAAATGAAAGGAAGCTTGG + Intronic
1099038774 12:77624035-77624057 CTACATAATAAAAGGAAGATGGG + Intergenic
1099694886 12:86005784-86005806 TTACATAAGGAAAGGAAGAATGG - Intronic
1099828172 12:87806101-87806123 TCAAATAATGAGAGCAAACTAGG + Intergenic
1101211585 12:102540120-102540142 TGAGATAATGAGAGGCAGCCCGG + Intergenic
1101988764 12:109467667-109467689 TTTCATAATGATATGAAGCAGGG + Intronic
1103124044 12:118406012-118406034 TTTCAAAATGAAAGGGAGCTTGG - Intronic
1105758237 13:23489546-23489568 TCAGGTAATGAGAGGAACCTCGG - Intergenic
1106015127 13:25862192-25862214 TTCCATAAGGAAAGGTAGCTTGG + Intronic
1107578464 13:41753621-41753643 TTTCATAATGCCAGCAAGCTGGG - Intronic
1109123023 13:58482529-58482551 TTACATGGTGAGAGGAAGGAAGG + Intergenic
1109550181 13:63885197-63885219 TTACATAGTGACAGAAACCTTGG - Intergenic
1111781461 13:92731395-92731417 TGAAATAATGAGAGAAAACTGGG + Intronic
1112020183 13:95364663-95364685 TTACATAATGAGGAGAATGTTGG + Intergenic
1112571003 13:100593459-100593481 TTACAAAATGAAATGTAGCTGGG + Intergenic
1114902788 14:27085709-27085731 TAGCATAATGAGTCGAAGCTGGG - Intergenic
1117741063 14:58819864-58819886 TTTCATCATCAGAGGAGGCTGGG + Intergenic
1118878485 14:69805513-69805535 TAACAGAATGAGATGAAGCATGG + Intergenic
1121984343 14:98487963-98487985 TTAAATATTGAAAGGTAGCTGGG + Intergenic
1125028036 15:35050412-35050434 TGAAAGAATGAGAGGAAGCGAGG - Intergenic
1125964878 15:43866002-43866024 TAACTTAATGAGAAGAAACTTGG + Intronic
1126434328 15:48620448-48620470 ATAATTAATGTGAGGAAGCTGGG + Intronic
1127912735 15:63431491-63431513 TTAAATAATTGGAGGAAGCAGGG + Intergenic
1133674386 16:8056797-8056819 TTCTATAATGAGAGGATTCTAGG + Intergenic
1133776096 16:8896359-8896381 TTACCTAATAAGAGTAAGCGAGG - Intronic
1134903887 16:17962805-17962827 TTCCATAATGATTTGAAGCTTGG - Intergenic
1140961994 16:79924119-79924141 TTAAATAAGGACAGGAAGCAAGG + Intergenic
1144991953 17:19238885-19238907 TTACATAATGAGAGGAAGCTTGG - Intronic
1148817409 17:50339776-50339798 TAAAATAATGAGGGGAAGGTTGG - Intergenic
1149257171 17:54839631-54839653 TAACATAATGAGAAGAACATAGG - Intergenic
1149828039 17:59847544-59847566 TTAACTAATGAAAAGAAGCTGGG - Intergenic
1149914206 17:60593599-60593621 CTATTTAAAGAGAGGAAGCTTGG - Intergenic
1155720845 18:29009783-29009805 TTACAGAATGAGATGGAGGTAGG - Intergenic
1156902716 18:42320191-42320213 TTTCTTAATGAGAGGATTCTTGG - Intergenic
1158769293 18:60495393-60495415 TTACATAAAGAGAGCAAGTAAGG - Intergenic
1158855849 18:61542807-61542829 TCACATGGTGAGAGGAAGCAAGG + Intronic
1159075286 18:63674376-63674398 TAACAGAAGGAGAGGAAGCAGGG - Intronic
1164392873 19:27840947-27840969 GTACAGAATGAGAGGCAGGTTGG - Intergenic
925318858 2:2946552-2946574 TTACATTATGAAAGGGAGCATGG - Intergenic
926893722 2:17661115-17661137 TTACAGAATGAGAGGAAATATGG - Intergenic
929252370 2:39773022-39773044 TGACATTATGGGAGGAAGCAGGG + Intronic
930456226 2:51610888-51610910 TTACATAATTGCAGGTAGCTTGG - Intergenic
933142315 2:78807977-78807999 TTTGATAATGAGAAGAAACTAGG + Intergenic
934789104 2:97043008-97043030 TTACATAATAAGAACAAGATTGG - Intergenic
934817372 2:97339549-97339571 TTACATAATAAGAACAAGATTGG + Intergenic
934820324 2:97368935-97368957 TTACATAATAAGAACAAGATTGG - Intergenic
934920666 2:98342724-98342746 TTAAATACTGAGGGCAAGCTTGG - Intronic
936154232 2:110037687-110037709 TTACACTCTGAGGGGAAGCTGGG - Intergenic
936190452 2:110333728-110333750 TTACACTCTGAGGGGAAGCTGGG + Intergenic
936630409 2:114196186-114196208 TTACCTATTGAAAGGAATCTTGG + Intergenic
937713183 2:125001655-125001677 TAACAGAAAGAAAGGAAGCTTGG + Intergenic
937753110 2:125501814-125501836 TTACAGAATGAGCAAAAGCTGGG - Intergenic
940287475 2:152046995-152047017 TTTCAGGCTGAGAGGAAGCTGGG - Intronic
940481465 2:154237271-154237293 TTACATAATAAGATTAAGGTAGG - Intronic
940599296 2:155837432-155837454 CTACATAATGAGATGAAGTGAGG + Intergenic
941286219 2:163616310-163616332 TTTCAAAATGAGAGGAAAATTGG + Intronic
942985623 2:182137667-182137689 TTACAGAAGGAAAGGGAGCTGGG - Intergenic
943026553 2:182636506-182636528 TTACATGATGAAGGGAAACTGGG - Intergenic
943259406 2:185639835-185639857 TTACATAAAGAAATAAAGCTGGG - Intergenic
945753041 2:213812162-213812184 TCACAGAATGAGAGGAACTTAGG + Intronic
946869711 2:224074773-224074795 TTCCACAATGAGAGGATGATCGG + Intergenic
1169822744 20:9730987-9731009 TGACATAGTGGGAGAAAGCTTGG + Intronic
1172665665 20:36597870-36597892 TTACAAGATGAGAGGAAGAAGGG + Intronic
1173296526 20:41764095-41764117 TTACATCATGATAAGAAGCATGG - Intergenic
1174910448 20:54602328-54602350 TTGCATCATGGGAGGGAGCTGGG + Intronic
1177734699 21:25074010-25074032 TTATATAGTAAGAGGAAGCAAGG + Intergenic
1181894716 22:26096920-26096942 GTACATAATGAAAGGATCCTGGG + Intergenic
949380865 3:3444233-3444255 TTAAAGAATGAGAGGAATCAGGG + Intergenic
950984088 3:17341706-17341728 TTAAATGATGAGAAGTAGCTGGG + Intronic
952365723 3:32673245-32673267 TGACATAGTGAGGGGAAGCAGGG + Intergenic
952779018 3:37076061-37076083 TTACATAAGGAAAGAAAGCCAGG + Intronic
955934188 3:64087064-64087086 TTACATAATAAGAGCAGGCAAGG + Intergenic
957682152 3:83450655-83450677 TTACATTATGAGAGTAAGGCAGG - Intergenic
958055810 3:88409317-88409339 TCAGAAAATGTGAGGAAGCTTGG - Intergenic
960253100 3:115479046-115479068 CTTCATAAAGAGAGTAAGCTGGG + Intergenic
962003344 3:131323500-131323522 TTCCAGAAAGAGAGGAAGATGGG - Intronic
962720709 3:138172286-138172308 TTAAATAAAGGGATGAAGCTGGG + Intronic
963023391 3:140895076-140895098 TTATATAATGATAGAAAGATCGG - Intergenic
963563461 3:146897495-146897517 TTACCTAATAAGAGAAAACTTGG - Intergenic
964780674 3:160334255-160334277 TGACAGAATGATAGGATGCTAGG + Intronic
965729287 3:171753705-171753727 TGAAATAATGAGAGGACGGTTGG - Intronic
965756935 3:172037228-172037250 TTGCAAAATGAGAGGAAGTATGG - Intergenic
969534412 4:7747092-7747114 GTGCATCAAGAGAGGAAGCTGGG + Intergenic
971769520 4:30878503-30878525 ATGCAAAAGGAGAGGAAGCTGGG + Intronic
971891219 4:32524908-32524930 TTACATAATGAGAAACAGCTAGG + Intergenic
972246128 4:37246369-37246391 TTACATTATGAGAAGGAGTTGGG + Intronic
972690459 4:41392622-41392644 TTACATTATGAGAGGCATGTGGG + Intronic
975174861 4:71276707-71276729 TTACATATTAAGAGGCATCTTGG + Intronic
975845165 4:78517217-78517239 GTACAAAATGAGAGGAAACCAGG - Intronic
976749642 4:88441157-88441179 TTAGATAATTAGATGAAGATAGG - Intronic
976752150 4:88460317-88460339 ATACATAATGAGAGAATTCTTGG + Intronic
976820952 4:89206577-89206599 TTAGATACTGAGAGGAACATAGG + Intergenic
977091474 4:92681953-92681975 TTATTTAAAGAGAGGAAACTTGG + Intronic
977461487 4:97331440-97331462 TTACATATTGGGAGAAAGTTTGG + Intronic
980424661 4:132611721-132611743 TAACATAATGAGAGAATGCATGG - Intergenic
981114473 4:140973940-140973962 TGACACCATCAGAGGAAGCTGGG - Intronic
981241643 4:142483626-142483648 TGATATGATTAGAGGAAGCTGGG + Intronic
984499279 4:180537779-180537801 TTATTTAATGAGAGGATGTTTGG + Intergenic
985215270 4:187646435-187646457 TTACCTAATGAGATGAAGTGAGG - Intergenic
986684562 5:10265162-10265184 TTTCATATTGAGAGGAATATGGG + Exonic
988118777 5:26932527-26932549 TTACATAATGATAAGAAGATTGG - Intronic
988595866 5:32590258-32590280 TTACCAAATTAGATGAAGCTAGG - Intronic
988695382 5:33616544-33616566 TTTCTTAATGAATGGAAGCTAGG - Intronic
990095318 5:52104227-52104249 TTAAAGAATGAGAGGAAACAAGG - Intergenic
990191329 5:53263417-53263439 TATCATAATGAGCAGAAGCTTGG - Intergenic
990914388 5:60888011-60888033 TTACTTCATAAGGGGAAGCTTGG + Intronic
995580714 5:113599122-113599144 TTTCAGAATGACAGGAAGTTAGG - Intergenic
996970182 5:129357770-129357792 TAACATACTGACAGGAAACTGGG - Intergenic
997690092 5:135822464-135822486 TTGCATCATCACAGGAAGCTAGG - Intergenic
998171785 5:139876756-139876778 TAACAAACTGAGAGGAAGGTAGG - Intronic
1000105922 5:158058664-158058686 TCGCATAAAAAGAGGAAGCTAGG + Intergenic
1000768105 5:165317194-165317216 TTACATAATAAGATGAAGTGAGG - Intergenic
1003009628 6:2414421-2414443 TTACATCATGGGATGCAGCTTGG - Intergenic
1006201761 6:32299488-32299510 AAACATAATGAAAGGAAGATTGG - Intronic
1006723649 6:36179205-36179227 TTACAAATTGGGAGGAAACTGGG + Intergenic
1008045420 6:46847210-46847232 TTATAAAGTGAGATGAAGCTGGG + Intergenic
1008320701 6:50109665-50109687 TTACATAAAGAGAGAAAACCAGG + Intergenic
1008516158 6:52321097-52321119 ATAAATAATGAGAGGTAGCCTGG + Intergenic
1009433729 6:63594453-63594475 ATAGATAATGAGGGGAAGCCAGG - Intergenic
1009891643 6:69691573-69691595 TTACCTAAAGAAAGAAAGCTTGG + Intronic
1010631911 6:78208302-78208324 TCAGAAAATGAGAGGAAGATAGG - Intergenic
1010815416 6:80352477-80352499 TTACAGAATGAGAGAAAGAATGG - Intergenic
1011426542 6:87238186-87238208 TTAAATATTAAGAGTAAGCTGGG + Intronic
1011602614 6:89074108-89074130 ATACATAATGATAAGAAACTAGG + Intergenic
1011636514 6:89379607-89379629 TTGCAGAATGTCAGGAAGCTGGG - Intronic
1011969456 6:93204142-93204164 TTATATAATGGAAGGAAGTTGGG + Intergenic
1014006304 6:116423018-116423040 TTACACAAGGAATGGAAGCTGGG - Intronic
1015063627 6:128998172-128998194 TTACATAAGGAGAGGTAGGAAGG + Intronic
1017927657 6:158924259-158924281 CCACATAATGAGCGGAAGGTCGG + Intergenic
1020527695 7:9283964-9283986 TGACATAATGAAATAAAGCTGGG + Intergenic
1023507650 7:40917479-40917501 TCACAAAAGGAGAGGAATCTGGG - Intergenic
1027863536 7:83616260-83616282 TTACAAAATTTGAGGTAGCTAGG + Intronic
1028242029 7:88433306-88433328 TGGAATAATGAGAGGAGGCTGGG + Intergenic
1028825806 7:95272196-95272218 TTCCTGAATGAGAGGTAGCTGGG - Intronic
1031034203 7:116769800-116769822 TTACATCATGAGAGGAATGCAGG - Intronic
1031297660 7:120023882-120023904 CTGCATAATGAAGGGAAGCTTGG + Intergenic
1032370123 7:131340572-131340594 ATACATAATTACAGGAAGCCGGG - Intronic
1033434014 7:141315890-141315912 TTACATACTGATGGGAAGTTGGG - Intronic
1033471529 7:141654043-141654065 TTACATTATGATAGGATTCTTGG - Exonic
1033843787 7:145407081-145407103 CTACATAATGAGATGAAGTGAGG - Intergenic
1037106407 8:15113477-15113499 TTAGTTATTGAGAGGAAGCAGGG - Intronic
1037990586 8:23319072-23319094 TTACATAACGGGAAGATGCTTGG - Intronic
1038256904 8:25958633-25958655 TTAAAAAATTAGAAGAAGCTGGG - Intronic
1039267994 8:35848637-35848659 TTAAAAAATGAGAGAAATCTTGG + Intergenic
1039765622 8:40625209-40625231 TTAAAAAATGAGAGGAAGAACGG + Intronic
1040518205 8:48151595-48151617 CTACATGGTGAGATGAAGCTAGG - Intergenic
1041861173 8:62514127-62514149 TCAAACAATGAGAGTAAGCTGGG - Intronic
1041913309 8:63113330-63113352 TTACATAGTGAGGGGGAGGTGGG + Intergenic
1041956777 8:63565154-63565176 TTGCATGATCAGAGGAAGCTGGG + Intergenic
1042651705 8:71049782-71049804 TTACATAAAGAGAGAAAAATGGG + Intergenic
1043057598 8:75459375-75459397 CTACATAATGAGAAGAATTTAGG - Intronic
1043887977 8:85624286-85624308 ATGCATAAGGAGAGGAAACTTGG + Intergenic
1045466511 8:102475490-102475512 TTACAGAATGATAGGAAGAAAGG + Intergenic
1046423968 8:114022042-114022064 TTAAATTATGAGAGGAAGAGAGG - Intergenic
1046990760 8:120450384-120450406 TTAACTAATGGAAGGAAGCTAGG - Intronic
1047900720 8:129419269-129419291 TTACATAGTGTGGGGAAGCTTGG - Intergenic
1048543204 8:135361837-135361859 TCACAGAATGAAAGGAACCTGGG + Intergenic
1050057935 9:1675200-1675222 CTCCATAATGTGAGGAAACTGGG + Intergenic
1050454672 9:5822328-5822350 CTAACTAATGAGAAGAAGCTGGG - Intronic
1053167519 9:35854932-35854954 TTACATAATGCCAAGAAGTTGGG + Intergenic
1053652146 9:40179523-40179545 TTATAAAGTGAGATGAAGCTTGG - Intergenic
1053902539 9:42808837-42808859 TTATAAAGTGAGATGAAGCTTGG - Intergenic
1054450107 9:65398864-65398886 GTAGATAATAAGAGGGAGCTAGG + Intergenic
1054532438 9:66196683-66196705 TTATAAAGTGAGATGAAGCTTGG + Intergenic
1054985128 9:71252985-71253007 TTCCATAATGAAAGAAATCTTGG - Intronic
1055192027 9:73536806-73536828 TAATAAAATGAGAGAAAGCTAGG + Intergenic
1058287318 9:103194955-103194977 TTACCTAATGAAAGGAACCAAGG + Intergenic
1058569071 9:106321214-106321236 TCAAATGATGAAAGGAAGCTTGG - Intergenic
1059954728 9:119503401-119503423 TAACCTAATGCAAGGAAGCTAGG + Intronic
1060800032 9:126538183-126538205 TTACATAATGAGGAGAAGTGGGG - Intergenic
1062727758 9:138086046-138086068 ATAAATAATGAGAGGAAGAAAGG + Intronic
1185969840 X:4650216-4650238 TTGCATAATCACTGGAAGCTGGG - Intergenic
1188065204 X:25650408-25650430 TTGCATAATGTGAGTTAGCTGGG - Intergenic
1189116720 X:38350527-38350549 TGACATAATCAGCAGAAGCTGGG + Intronic
1190393921 X:49960494-49960516 TTACCTGCTGAGGGGAAGCTGGG - Intronic
1190443213 X:50496356-50496378 TGGCATAATGAGAGGAATTTGGG + Intergenic
1190758984 X:53424078-53424100 ATAAATAAAGGGAGGAAGCTTGG + Intronic
1193274837 X:79573112-79573134 TTAGGTAATGAGTGGATGCTGGG + Intergenic
1193545858 X:82827949-82827971 TTACTTACTGAGAGCACGCTGGG + Intergenic
1193667779 X:84344320-84344342 TCACACCAGGAGAGGAAGCTGGG - Exonic
1194375379 X:93126151-93126173 TTCCATATTGTGAGGAAGCTTGG - Intergenic
1199765010 X:150935089-150935111 CTCCATATTGAGAGGAAGGTGGG - Intergenic