ID: 1144994503

View in Genome Browser
Species Human (GRCh38)
Location 17:19258093-19258115
Sequence AACCAGTTAGATGTGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144994503 Original CRISPR AACCAGTTAGATGTGGGTGA GGG Intronic
900110584 1:1003887-1003909 CACCCGTTAGATGGGGGGGAGGG - Intergenic
901456027 1:9363370-9363392 AACCAGTTAGGGATGGGTCATGG - Intronic
901539646 1:9907631-9907653 AACCAGTTAGAGGTGGAGGAGGG - Intronic
901973635 1:12927638-12927660 TACCAGTTAGATGAAGGTGGTGG - Intronic
902011543 1:13274129-13274151 TACCAGTTAGATGAAGGTGGTGG + Intergenic
905026732 1:34855608-34855630 AGCCAATTAGATGTGGGTTCTGG + Exonic
906360044 1:45147904-45147926 AAACAGAGAGATGTGGGGGAGGG + Intronic
907033120 1:51192052-51192074 TAGGAGTTAGATGGGGGTGATGG - Intergenic
907875949 1:58488768-58488790 AAACAGTGAGAAGTGGGTGAGGG - Intronic
908641785 1:66231943-66231965 AACCAGTCAGGTTTGGGAGATGG - Intronic
909943284 1:81635039-81635061 AACCAGTGAGATAGGGGAGAAGG + Intronic
910591991 1:88935707-88935729 AAACAAATAGATGTGGTTGAGGG + Intergenic
910895587 1:92066221-92066243 AAGCAGTTGGATGTGGGGAAGGG + Intergenic
911716795 1:101142511-101142533 ATCCAGTTCCATGTGGCTGAAGG + Intergenic
915940349 1:160114874-160114896 AACCTCTAAGATGTGTGTGAAGG - Intergenic
917287608 1:173437542-173437564 AATTAGTTAAATGTGGGAGAAGG - Intergenic
918083465 1:181224978-181225000 AAGCAGGGAGAAGTGGGTGATGG + Intergenic
919058422 1:192599929-192599951 TACCACTTAGAGGTGGGTGATGG - Intergenic
921335898 1:214085917-214085939 AAGCAGTTAGATGTGGGGAGAGG - Intergenic
923753054 1:236764813-236764835 AACCATTTAGAAGTGAATGATGG + Intergenic
1063121700 10:3109327-3109349 AACCAGGTCCATGTGGGTCAGGG - Intronic
1063274587 10:4551251-4551273 AACCTGTTGCAGGTGGGTGATGG + Intergenic
1068403014 10:56554623-56554645 AAGCAGTTACAAGTGGCTGAAGG - Intergenic
1068461575 10:57336695-57336717 AATCAGTAGGATGTGGGTGGGGG - Intergenic
1068509242 10:57943052-57943074 AACCCCTGAGATGTGGGTGTAGG + Intergenic
1070459752 10:76652674-76652696 AACTAGATAGATGTGGTTGCAGG - Intergenic
1072338365 10:94421156-94421178 AACCAGGTGGAGGTGGGTGGAGG - Intronic
1072830349 10:98650985-98651007 AAGCAGTTTGATGTGTGTGTTGG - Intronic
1074039416 10:109773388-109773410 AACCAGCTTGATGTGTCTGAAGG + Intergenic
1075011420 10:118873637-118873659 AATGATTCAGATGTGGGTGAAGG + Intergenic
1077241636 11:1513557-1513579 AGCCAGTGAGGTGTGGGAGATGG - Intergenic
1078281835 11:9910009-9910031 AATCAGTTCCACGTGGGTGAAGG + Intronic
1078462626 11:11526194-11526216 AGGAAGTTAGATGTGGGTGGAGG + Intronic
1080016165 11:27508801-27508823 TACCAGTTTGATTTGGGTGTGGG + Intergenic
1080759906 11:35238399-35238421 AACCAGAAAGAAGAGGGTGAAGG + Intergenic
1081178596 11:39959279-39959301 AACCAATTAGCTGTGCGTGGTGG + Intergenic
1082785598 11:57314597-57314619 TCCCAGTTAGGTGAGGGTGAAGG + Intronic
1085887273 11:80535532-80535554 AACAAGTTAGCTGGGGGTGGTGG + Intergenic
1087078075 11:94144037-94144059 ATCCAGTTAGATATGGGTGAGGG - Intronic
1087368102 11:97247808-97247830 AGCTAGTATGATGTGGGTGATGG + Intergenic
1088498941 11:110462809-110462831 TTCCTGTTTGATGTGGGTGAAGG + Exonic
1089919451 11:122194496-122194518 AAACAATTAGCTGTGTGTGATGG + Intergenic
1090821814 11:130349443-130349465 GGCCAGCTGGATGTGGGTGACGG - Intergenic
1091770670 12:3149110-3149132 AACTTGTTAGATGTAGATGAAGG - Intronic
1092062232 12:5560867-5560889 AAGAAATTAGATGTGTGTGAGGG + Intronic
1098165678 12:67695185-67695207 AACCAGTAAGATGGGGGAGGAGG - Intergenic
1099063553 12:77944359-77944381 GTCCAGTTGAATGTGGGTGACGG + Intronic
1099925903 12:89016802-89016824 AACTAGATAGAAGTAGGTGATGG + Intergenic
1103317955 12:120072149-120072171 AACCAGTTAGATGGAGAAGATGG - Intronic
1103569124 12:121832500-121832522 AACAAGTTACATATGGATGATGG - Exonic
1105895162 13:24711093-24711115 AACCTGTTGGATGAGGATGAAGG - Intronic
1108798487 13:54063981-54064003 AACCAGATTGAGGTGGGTAAAGG - Intergenic
1109630398 13:65037615-65037637 AACCTGGGAGATGGGGGTGAAGG - Intergenic
1109824947 13:67706644-67706666 GACCTGTCAGAAGTGGGTGAGGG + Intergenic
1112395743 13:99029220-99029242 GACCTGTGAGGTGTGGGTGATGG - Intronic
1112947770 13:104952837-104952859 AACCAGTGAGATGTGAGACAGGG - Intergenic
1113469750 13:110536029-110536051 CACCAGTTAGATGTGATTAAGGG - Intronic
1115875702 14:37858861-37858883 ACCCAGTTAGAAGTGAGGGACGG + Intronic
1117643562 14:57826675-57826697 AACTAGTAAGAAGTGGGTGAAGG + Intronic
1120638472 14:86980711-86980733 AACCTGTTGGTGGTGGGTGATGG + Intergenic
1129553125 15:76474945-76474967 AATGTGTTAGATGTGGGTCAAGG - Intronic
1130561201 15:84960624-84960646 AGCCACCTGGATGTGGGTGATGG + Intergenic
1133603901 16:7367197-7367219 AAACAGTAAGATGGGGGTGGGGG - Intronic
1135346344 16:21691816-21691838 AAACAGTTTGATGTGGCTTATGG + Intronic
1135756028 16:25098873-25098895 AAACTGTCAGATGTGGCTGAGGG - Intergenic
1137231798 16:46573631-46573653 AACCAGGGAAATGAGGGTGAGGG + Intergenic
1137392456 16:48092746-48092768 AAGCAGGTTGATGTGGGAGAGGG + Intronic
1143645830 17:8229419-8229441 AGCCAGGTAGATGTGGGGCAGGG + Exonic
1143875036 17:9985090-9985112 AACCAATTAGATATGAGGGATGG - Intronic
1144994503 17:19258093-19258115 AACCAGTTAGATGTGGGTGAGGG + Intronic
1147583302 17:41638676-41638698 AACCAGTCAGAGGTGAGTGAGGG - Intergenic
1147853022 17:43457026-43457048 AACCACAGAGATGTGGGTGGAGG + Intergenic
1149565958 17:57640666-57640688 AACTAGTTAAGTGTGGGAGATGG + Intronic
1150174924 17:63043765-63043787 AATCATTTAGATGTAGCTGATGG + Intronic
1152135602 17:78501474-78501496 ATACAGTTGGATGTGGGTGCTGG - Intronic
1152743365 17:82028306-82028328 AACCAGGTAGCTGTGGTGGATGG + Exonic
1154337584 18:13477872-13477894 AACCAGTGAGATGTGCCTGCTGG - Intronic
1159069716 18:63610407-63610429 AACCAATTTTAGGTGGGTGAGGG - Intergenic
1159377234 18:67608074-67608096 AACCAGTAAAATTTGGGTGTGGG + Intergenic
1160076901 18:75686215-75686237 ATACAGTTAGATATGGGTTATGG - Intergenic
1161412198 19:4123185-4123207 AAGCAGTGAGATCGGGGTGAGGG - Intronic
1162345464 19:10115711-10115733 AGCCAGGTAGATGCGGGAGATGG + Exonic
1165394977 19:35558980-35559002 GACCAGTCAGGTGTGGGGGAGGG - Exonic
1165587578 19:36932860-36932882 AACCAATTAGAAGTGGGCAAAGG - Intronic
1166381139 19:42356000-42356022 AACCAGGTACAGGTGGGAGAGGG + Exonic
1166382059 19:42360199-42360221 AACCAGATAGATGTGGCGGCTGG - Intronic
925665492 2:6250851-6250873 AAACAGTTAGCTGGGGGTGGTGG + Intergenic
925772835 2:7300230-7300252 AACCACTTTGATTTGGGTGGGGG + Intergenic
926047328 2:9719203-9719225 AATCAGTGAGATATGGGAGAGGG + Intergenic
926147663 2:10406491-10406513 AACCACTGAGGTGTGGGTGAAGG + Intronic
927778913 2:25923859-25923881 AACCATGCAGATGTGGGGGAGGG - Intergenic
928427126 2:31188554-31188576 GACTAGTTAGATGAGGGTGCAGG - Intronic
929207970 2:39319891-39319913 AAACATTTAGATATGGGGGATGG + Intronic
931890216 2:66662842-66662864 AAGCAGTTATATGTGAGTGGGGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936820261 2:116511213-116511235 AACCAGTTTCACCTGGGTGATGG - Intergenic
941129311 2:161626232-161626254 AGCCAGTTTGATGTGGCTTATGG + Intronic
941245882 2:163096322-163096344 AACAACTTAGTTGTAGGTGATGG + Intergenic
944441768 2:199750512-199750534 AACCAGTTAGGTGTGGGAAGGGG - Intergenic
945613421 2:212035406-212035428 AACTAGTTAGAAGTGGGTGGAGG - Intronic
1168767022 20:388580-388602 AGCCAGGTAGAAGTGGGAGATGG + Intronic
1168912808 20:1463372-1463394 AACCTATGAGATGTTGGTGATGG - Intronic
1169189509 20:3648979-3649001 AACCAGATGGCTGTGGGTCATGG - Exonic
1169940742 20:10934381-10934403 AGACACTTAGATGTGGCTGAAGG - Intergenic
1170428300 20:16257043-16257065 AACCAAACAGATGTGGGAGAGGG - Intergenic
1171960861 20:31493060-31493082 AACGAGGGAGAAGTGGGTGAAGG + Intergenic
1172584635 20:36074232-36074254 AAACACATTGATGTGGGTGAAGG - Intergenic
1173884308 20:46443953-46443975 AAGGAGTTAGATGTGGGGCAGGG - Intergenic
1174306002 20:49614804-49614826 ACCCAGTGCTATGTGGGTGAAGG - Intergenic
1174436916 20:50514914-50514936 AACCAGTGAAATGTGGCAGAGGG - Intronic
1175475895 20:59274051-59274073 AACCTGGGAGATGTGGGGGAGGG + Intergenic
1176203152 20:63873133-63873155 AACCATTTAGTTGTGGGGCATGG + Intronic
1177673931 21:24272139-24272161 TACAATTTTGATGTGGGTGATGG - Intergenic
1184782121 22:46654738-46654760 AACCAGCAAGATGTGGGGAAGGG - Intronic
949787531 3:7758372-7758394 AACCAGTGAACTGTAGGTGAGGG - Intergenic
949860077 3:8497282-8497304 CACCAGCCAGATGTGGTTGATGG + Intergenic
951822230 3:26826096-26826118 AACCAGTGAAATATGGATGAAGG - Intergenic
952460247 3:33517419-33517441 AAACTGTTAAATCTGGGTGATGG - Intronic
952920300 3:38279315-38279337 AACCAGATAGAAGTGGGGAAAGG + Intergenic
954375568 3:50192528-50192550 AACCAGCTGGAGGTGGGTGAGGG + Intronic
955537640 3:59941368-59941390 AAACAGTGAGAGGTGGGTAAAGG - Intronic
962032512 3:131616206-131616228 AAGCAGTTAGCTGTGGGAGTAGG + Intronic
963609231 3:147444074-147444096 AAACAATTAGATGGGGGTGGTGG + Intronic
964485435 3:157180789-157180811 AACCCCCTACATGTGGGTGAAGG + Intergenic
964569090 3:158093610-158093632 AATCAGTTTAATGTGTGTGAGGG - Intergenic
967903338 3:194480068-194480090 AACAAGTCAGATGTGTGTGTGGG - Intronic
972050996 4:34733224-34733246 AACAGTTTAGATGTGGGTGCAGG - Intergenic
973812225 4:54582516-54582538 AGCCAGTTATTTGTGGGGGATGG - Intergenic
974821693 4:67074590-67074612 AACCAGTTGCATGTGGGGGTTGG - Intergenic
974866643 4:67589264-67589286 AATCAGTTACAAGTTGGTGAAGG - Intronic
975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG + Intergenic
977700554 4:100017349-100017371 AACCTGTTAAATGTGGCTGGTGG + Intergenic
978196418 4:105977695-105977717 ACCCAGTTAAAAGTGGGTTAGGG + Intronic
978383069 4:108151223-108151245 GACCAGTTAGATGTGGAGGAGGG - Intronic
979306553 4:119151355-119151377 AACCAGTTACATGTTTGAGATGG + Intronic
979438328 4:120721340-120721362 AACTAGTTAAATCAGGGTGAGGG - Intronic
984143526 4:176033407-176033429 AACCATTAAAAAGTGGGTGAAGG + Intergenic
987800252 5:22686675-22686697 AATCAGTAGGATGGGGGTGATGG + Intronic
988918783 5:35921826-35921848 TACCAGGCAGATGGGGGTGAGGG - Intronic
990126486 5:52524917-52524939 AACCAATTAGATGTAGATGTAGG + Intergenic
990159604 5:52923112-52923134 AAGGAGTTAGATGTGGGGCAGGG + Intronic
992023407 5:72647643-72647665 ACCCAGTGAGATGAGGGGGAGGG + Intergenic
1003220994 6:4160870-4160892 CACCAGTTAGCTGTGGGGGCAGG - Intergenic
1004955887 6:20727164-20727186 AAACAGTTACCTGTGGGTCAAGG - Intronic
1006345011 6:33473859-33473881 AACCAGCTAGATGTGTGTGGGGG - Intergenic
1006909277 6:37553652-37553674 AACCAGCAAAGTGTGGGTGAGGG + Intergenic
1007886136 6:45232610-45232632 AACCTGTGTGATGTGGGTGATGG + Intronic
1009768851 6:68119109-68119131 AACCAGAAAGATGTAAGTGAAGG + Intergenic
1010948840 6:82010679-82010701 AACCATCAAGAAGTGGGTGAAGG - Intergenic
1012599699 6:101079874-101079896 AAACAGTCAGATGAGGGTGAAGG - Intergenic
1013111130 6:107066140-107066162 AAGAATTTAGATGTGGGGGAAGG + Exonic
1013210486 6:107982635-107982657 CAGCAGTTAGGTGTGGGGGAAGG + Intergenic
1017505798 6:155067607-155067629 ACCTAGTTAGATGAGGGTTAGGG + Intronic
1018174490 6:161167131-161167153 AAACAGTTGAATGTGGGTGATGG + Intronic
1020379133 7:7523308-7523330 AAAAAGTTAGCTGGGGGTGATGG - Intronic
1023240419 7:38140402-38140424 AACCAGTGAGATCTGGATGCAGG + Intergenic
1023599946 7:41872313-41872335 ACACAGTTATATGTGGGTTAGGG - Intergenic
1028350606 7:89842481-89842503 AATCAGTGAGAAGTGAGTGATGG + Intergenic
1030557702 7:111047620-111047642 ATACAGTTAGATGAGTGTGAAGG - Intronic
1031079481 7:117244194-117244216 AAACAATTAGCTGTGCGTGATGG + Intergenic
1039201492 8:35098512-35098534 AACAGAGTAGATGTGGGTGATGG - Intergenic
1041409821 8:57541124-57541146 AACCAGGTTGCTGTGTGTGATGG - Intergenic
1042463110 8:69094053-69094075 AACTATTTAGAAGGGGGTGAAGG + Intergenic
1042736155 8:71991929-71991951 GACCAGTTGGATGTGGGGGCTGG - Intronic
1044360258 8:91275072-91275094 AACCAGATAGATGAGGGTGAGGG - Intronic
1046741204 8:117830916-117830938 ATCCAGTTAGACTTGGGTAAAGG - Intronic
1048453839 8:134559218-134559240 AACCTGTTGCAGGTGGGTGAGGG - Intronic
1050061231 9:1711843-1711865 ACCAAGAGAGATGTGGGTGAGGG - Intergenic
1050691679 9:8234385-8234407 TACCAGGGAGGTGTGGGTGATGG + Intergenic
1051599126 9:18854481-18854503 AACCAGGTAGTTGAGGGAGATGG + Intronic
1051888471 9:21919256-21919278 AAACAATTGAATGTGGGTGATGG - Intronic
1052780705 9:32779676-32779698 AACCTGAGAGATGGGGGTGATGG + Intergenic
1054805258 9:69391371-69391393 AACCAGTTAAGTGTGGTTTACGG + Intronic
1056688461 9:88785841-88785863 AACCACTCAGATGTGGGGGGTGG - Intergenic
1058577350 9:106418006-106418028 AACAAGTAATATGAGGGTGAAGG + Intergenic
1059402829 9:114081282-114081304 AACCATTTGGTTGTGGGGGAGGG + Intergenic
1060431554 9:123555216-123555238 AACCAGTTAGAGGAGTGTTATGG - Intronic
1062379070 9:136278057-136278079 CACCAGTTAGATGGGGGCCACGG - Intergenic
1186328883 X:8511276-8511298 GGCCGGATAGATGTGGGTGAAGG - Intergenic
1188360045 X:29241970-29241992 CATCAGTTAAATGTGGGTGTTGG - Intronic
1189018111 X:37305503-37305525 AACCAGCAACAAGTGGGTGAAGG - Intergenic
1189446621 X:41086152-41086174 CAACAGCTGGATGTGGGTGAGGG + Intronic
1192578672 X:72262973-72262995 AACCAGACAGATGTGGGGGCGGG + Intronic
1195936861 X:110133892-110133914 AGTCAGTTAGATGTGGGAGGAGG + Intronic
1196174664 X:112627695-112627717 AACCACTTAGATCTTGGGGAGGG - Intergenic
1198012498 X:132572577-132572599 ATCCAGTTTGATGTTGTTGAAGG - Intergenic
1199826063 X:151501287-151501309 AACCAGTGTGATGTTGGTGGAGG + Intergenic
1201433414 Y:13929501-13929523 GGCCGGATAGATGTGGGTGAAGG + Intergenic