ID: 1144998173

View in Genome Browser
Species Human (GRCh38)
Location 17:19285367-19285389
Sequence CTGTAGCCATAGGTCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144998163_1144998173 3 Left 1144998163 17:19285341-19285363 CCTCCTCCTCATACCGAGTCCAG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1144998162_1144998173 4 Left 1144998162 17:19285340-19285362 CCCTCCTCCTCATACCGAGTCCA 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1144998160_1144998173 8 Left 1144998160 17:19285336-19285358 CCACCCCTCCTCCTCATACCGAG 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1144998159_1144998173 19 Left 1144998159 17:19285325-19285347 CCTGGTTTGATCCACCCCTCCTC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1144998167_1144998173 -3 Left 1144998167 17:19285347-19285369 CCTCATACCGAGTCCAGGGCCTG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1144998161_1144998173 5 Left 1144998161 17:19285339-19285361 CCCCTCCTCCTCATACCGAGTCC 0: 1
1: 0
2: 3
3: 88
4: 581
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1144998168_1144998173 -10 Left 1144998168 17:19285354-19285376 CCGAGTCCAGGGCCTGTAGCCAT 0: 1
1: 0
2: 3
3: 19
4: 157
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1144998166_1144998173 0 Left 1144998166 17:19285344-19285366 CCTCCTCATACCGAGTCCAGGGC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144998173 Original CRISPR CTGTAGCCATAGGTCCTGCT GGG Intronic
900599311 1:3496322-3496344 CTGTGGCCAAGCGTCCTGCTGGG - Intronic
901177308 1:7313858-7313880 CTGCAGCCATCGGTCATCCTTGG + Intronic
901213953 1:7543379-7543401 CTGCAGCCACAAGTGCTGCTGGG - Intronic
904631859 1:31848480-31848502 CAGGAGCCATCGGTGCTGCTTGG + Intergenic
907803475 1:57794850-57794872 CTATAGCCATGGGTCATTCTGGG - Intronic
911161475 1:94686378-94686400 CTGGCCCCCTAGGTCCTGCTGGG + Intergenic
911912430 1:103653183-103653205 CGGTAGACAGAAGTCCTGCTTGG + Intergenic
911916024 1:103698765-103698787 CGGTAGACAGAAGTCCTGCTTGG - Intronic
911919844 1:103747321-103747343 CGGTAGACAGAAGTCCTGCTTGG + Intronic
914087387 1:144465349-144465371 CTGTAGCCATTGGTATTTCTGGG - Intergenic
914311224 1:146468854-146468876 CTGTAGCCATTGGTATTTCTGGG + Intergenic
918536626 1:185582087-185582109 CTGGAGCTCTAGGTCCTGCAGGG + Intergenic
919504363 1:198379576-198379598 AGGTAGACATAGTTCCTGCTTGG + Intergenic
923663629 1:235979790-235979812 CTGTAGCCATGGGGGCTGCGTGG - Intronic
924672858 1:246147315-246147337 CAGGAGCCATAGGTCCAGCCAGG + Intronic
1065160607 10:22917163-22917185 CTGTAGCCATGGCTTCTACTAGG - Intergenic
1066269036 10:33804128-33804150 CTGGAGCCAGGGGTCCTGCGAGG + Intergenic
1070481779 10:76890035-76890057 CTGTCACCATAGGACCTGGTGGG - Intronic
1070541071 10:77415751-77415773 CTGTTCCCATGGGTCCTGCATGG + Intronic
1071071331 10:81697414-81697436 CTGCAGCCACATCTCCTGCTAGG - Intergenic
1073938118 10:108659468-108659490 CTGTAGCATTCGGTGCTGCTTGG - Intergenic
1075201648 10:120409468-120409490 CTGCAGCCACAGGTCCAGCTGGG - Intergenic
1077840916 11:5973912-5973934 TTGTAGCCAGAGGTCCTATTGGG + Intergenic
1082615705 11:55356851-55356873 CTGCAGCCAGAGGCCCTGCCTGG - Intergenic
1083412834 11:62505771-62505793 GTGTGGCCAGGGGTCCTGCTGGG - Intronic
1084193142 11:67508033-67508055 CTGGAGCCAGGGGTGCTGCTGGG + Exonic
1084950749 11:72664111-72664133 CTGCAGCCACAGCTCCTGCAGGG + Intronic
1085356572 11:75843623-75843645 CTCTAGCCCTATGTCCTTCTAGG + Intronic
1087710163 11:101539465-101539487 CAGTAGCCAAAAGGCCTGCTTGG - Intronic
1091631214 12:2162319-2162341 CTCCAGCCATCAGTCCTGCTTGG + Intronic
1091690273 12:2591500-2591522 CTGGAGGCAGAGGTTCTGCTGGG + Intronic
1092546847 12:9459723-9459745 CTGTAGGCATAGGACATGTTTGG + Intergenic
1093736508 12:22625674-22625696 ATGTTGCCCTAGGTCCTCCTCGG - Intronic
1094506090 12:31062349-31062371 CTGTAGGCATAGGACATGTTTGG - Intergenic
1101352058 12:103939434-103939456 CTGAAGCCATGGTTACTGCTAGG + Intronic
1102732568 12:115125882-115125904 CCATAGCCACAGCTCCTGCTGGG + Intergenic
1102943428 12:116963738-116963760 CCCTAGCCATAGTTCCTGCAGGG - Intronic
1104887641 12:132120005-132120027 CTATGGCCATAGGGCCTGGTGGG - Intronic
1111108214 13:83673604-83673626 CTATTGCCATAAGTCCTACTGGG + Intergenic
1111293894 13:86255617-86255639 CTTTAGCCATAGGTTTTGATGGG - Intergenic
1111637813 13:90928406-90928428 CTGTAACCACAGCTCCTGATGGG + Intergenic
1119669217 14:76506101-76506123 CTGAAGCCACAGGTGCTGCCTGG - Intergenic
1120183528 14:81369113-81369135 CTGTCGCCATAGCTCCTGTTGGG + Intronic
1130585119 15:85174518-85174540 GTGTAACTCTAGGTCCTGCTTGG - Intergenic
1132809787 16:1792059-1792081 CTGGAGCCACAGGCGCTGCTGGG - Exonic
1134222818 16:12368613-12368635 ATGGAGACAGAGGTCCTGCTTGG + Intronic
1135124851 16:19800116-19800138 CTTTAGCCATAGGTTTTGATGGG + Intronic
1137699994 16:50490572-50490594 CTGTGGTCAGTGGTCCTGCTGGG + Intergenic
1139327494 16:66163773-66163795 CTGTAGCCACAGGACCAGCGTGG + Intergenic
1140141144 16:72259143-72259165 CTGCAGCCCTAGGTGCTCCTTGG - Intergenic
1140561124 16:75982926-75982948 CAGAAGCCATAAGTCCTGCTGGG - Intergenic
1141855277 16:86676994-86677016 CAGTGGCCAAAGGTCCTGTTTGG - Intergenic
1143670368 17:8392409-8392431 CTGCAGGCAGACGTCCTGCTGGG - Exonic
1144998173 17:19285367-19285389 CTGTAGCCATAGGTCCTGCTGGG + Intronic
1149665193 17:58360286-58360308 CTGTAGCCATAGGAATTGCCAGG + Intronic
1151170277 17:72239830-72239852 CTGTAACCACAAGTCCTGCAGGG + Intergenic
1151175359 17:72283871-72283893 GTGTCTCCATAGGTCCTGTTTGG - Intergenic
1151270352 17:72990139-72990161 CACTACCCTTAGGTCCTGCTTGG + Intronic
1151628764 17:75295498-75295520 CTGTAGTCAAAGGTCCTTCCTGG - Intergenic
1153071695 18:1113362-1113384 CTGTATCCAGAGGTTTTGCTAGG + Intergenic
1157175390 18:45447084-45447106 CTTTGGCCATAGCTCCTGGTGGG + Intronic
1157687100 18:49651245-49651267 CTGAAGCCAGAGGTCCTCCTGGG + Intergenic
1157870895 18:51229301-51229323 ATGAAGCCATAGGTACAGCTTGG + Intergenic
1160675893 19:391019-391041 CTGTTGCCATGGTACCTGCTGGG + Intergenic
1160903529 19:1441036-1441058 CTGCAGCCATGGAGCCTGCTGGG - Intergenic
1162552154 19:11363964-11363986 CTGTGGACATAGGTCCTGGGCGG + Intronic
1163007964 19:14408142-14408164 CTGTGGCCACAGGAGCTGCTGGG - Exonic
1163488718 19:17605056-17605078 CTGAGGGCAAAGGTCCTGCTTGG + Exonic
1167037208 19:47001542-47001564 CTGTGGCCTGAGGGCCTGCTGGG + Exonic
925386857 2:3467979-3468001 CTCTGGTCAGAGGTCCTGCTAGG + Intronic
927395927 2:22651307-22651329 CTGTACCCAAAGGTCATGGTGGG - Intergenic
929235840 2:39604897-39604919 GTGTAGCATTAGCTCCTGCTGGG - Intergenic
932515152 2:72339287-72339309 ATGTATCCATTGGTTCTGCTTGG - Intronic
936491369 2:112975355-112975377 CTGGAGTCATAGGTCCTCCTTGG - Intronic
937345232 2:121121241-121121263 GTGTGGCCATAACTCCTGCTGGG + Intergenic
938237450 2:129717628-129717650 CAGTAGCCACAGCTCCTGCCAGG + Intergenic
942642526 2:178074813-178074835 CTGTAGCCATGTTCCCTGCTTGG + Intronic
948021608 2:234738033-234738055 CTGTAGCCAGAGGGCATGTTGGG - Intergenic
948890484 2:240904904-240904926 CTGAAGCCAGAGGTCATGCTTGG + Intergenic
948897227 2:240933123-240933145 CTGCAGGCACAGCTCCTGCTCGG - Intronic
1168976459 20:1969702-1969724 CTGTGGCCTTAGGGCCTGCCCGG + Intergenic
1169130815 20:3165644-3165666 CTGCAGCTGTAGGCCCTGCTGGG + Intronic
1170096461 20:12650771-12650793 CTCCAGCCATGGGTCCTGCATGG - Intergenic
1175222742 20:57426716-57426738 CAGGAGGCACAGGTCCTGCTGGG - Intergenic
1184638606 22:45856472-45856494 CTGTGGCCAAAGGTCTGGCTGGG - Intergenic
1184876546 22:47279471-47279493 CTGTAGCCATCTGTCATTCTGGG - Intergenic
950013833 3:9742499-9742521 CTGAAGCCCTAGGTCCTGACTGG + Intronic
950619681 3:14194876-14194898 CTGTAGCCAGATCTCCTGCCTGG + Intronic
951464774 3:22990190-22990212 CTGTGGCCGTACTTCCTGCTTGG - Intergenic
958713450 3:97747595-97747617 CTGTAACGAGATGTCCTGCTGGG + Intronic
963948959 3:151177724-151177746 CTCAAGCCATTGTTCCTGCTCGG + Intronic
965612678 3:170561391-170561413 CTTAAGCCTTAGGTCCTACTGGG + Intronic
966372584 3:179264580-179264602 CTGTAGCCATGTGTCGTACTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
980892389 4:138829628-138829650 ATGTAGCCAGAGGTCCCACTTGG - Intergenic
981872340 4:149501802-149501824 CTGTAGCCCTGGGTCTTGCAGGG - Intergenic
992415011 5:76544055-76544077 CTGTAGGAATGGGTCCTGGTAGG + Intronic
994330667 5:98502069-98502091 CCACAGCCATAGCTCCTGCTCGG - Intergenic
995479638 5:112581563-112581585 CTGAAGCAATATGGCCTGCTGGG + Intergenic
998160689 5:139811255-139811277 CTGCAGTCTCAGGTCCTGCTGGG + Intronic
1001466801 5:171974577-171974599 CTGTAGGCATAGGTTATGCTCGG - Intronic
1001681612 5:173561964-173561986 CTGTGGCCACAGGTACTGCTGGG + Intergenic
1004068954 6:12279086-12279108 CTGTAGTCATAAAACCTGCTTGG + Intergenic
1006570311 6:34997877-34997899 GTGTAGCCAAAAGTCCTCCTTGG - Intronic
1007284267 6:40736442-40736464 CAATAGCCTTAGGACCTGCTGGG - Intergenic
1011358657 6:86498845-86498867 CTGGGGCCATGGGTCCTGCAGGG + Intergenic
1012525281 6:100169969-100169991 CTGTAGAGATAGTCCCTGCTGGG - Intergenic
1013291224 6:108720377-108720399 CTGTAGTCATAGGTTCATCTGGG - Intergenic
1013366552 6:109441767-109441789 CTGAAGTCATAGGACCTTCTTGG - Intronic
1017135089 6:151140956-151140978 CTGTAGCCTTAGGACCAGCTGGG - Intergenic
1019749420 7:2719333-2719355 CTTTAGGCATTGCTCCTGCTTGG - Intronic
1020222606 7:6251860-6251882 TTGTAGCCAGACGTCCTGTTTGG - Intronic
1026368750 7:69676648-69676670 CTATAGCCATATGTCCATCTTGG + Intronic
1030221459 7:107103473-107103495 CTGTAACCAATGGTGCTGCTGGG - Intronic
1031604565 7:123752727-123752749 TTGTAGCCATAATTGCTGCTTGG + Intergenic
1033101994 7:138481733-138481755 CTGCAGCCCTGGGTCCTCCTGGG - Intronic
1035049210 7:155988807-155988829 CGGCAGCCTCAGGTCCTGCTGGG + Intergenic
1038515306 8:28182965-28182987 CAGTAGCCAGAGGTCATCCTTGG + Intronic
1039576257 8:38626265-38626287 CTGATGCAATAGGGCCTGCTGGG - Intergenic
1048840201 8:138558894-138558916 CTGGAGCCCTAGGTCTTGCAGGG - Intergenic
1049103845 8:140598852-140598874 CGGTAGCCATGAGTCCTGCAAGG - Intronic
1062418915 9:136469586-136469608 CTGTAGCCTTAAAACCTGCTGGG - Intronic
1189147459 X:38669805-38669827 CTGTAGTCAGAAGTCCTCCTAGG - Intronic
1189893575 X:45630557-45630579 CTGTGGCCACAGGTCTTGTTTGG - Intergenic
1194487695 X:94505812-94505834 CTGCAGCCATGGTTCCTCCTGGG + Intergenic
1198482065 X:137050539-137050561 CTGTAGCAATCAGACCTGCTGGG - Intergenic