ID: 1145000659

View in Genome Browser
Species Human (GRCh38)
Location 17:19302290-19302312
Sequence TCTCATCTGCAGAATGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 5, 2: 40, 3: 173, 4: 729}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145000659_1145000667 13 Left 1145000659 17:19302290-19302312 CCGTCCCCATTCTGCAGATGAGA 0: 1
1: 5
2: 40
3: 173
4: 729
Right 1145000667 17:19302326-19302348 GAAGGTAATCACCTAGGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 134
1145000659_1145000670 28 Left 1145000659 17:19302290-19302312 CCGTCCCCATTCTGCAGATGAGA 0: 1
1: 5
2: 40
3: 173
4: 729
Right 1145000670 17:19302341-19302363 GGCCAGGGGTCCCCAACCTCCGG 0: 1
1: 13
2: 86
3: 331
4: 818
1145000659_1145000664 -5 Left 1145000659 17:19302290-19302312 CCGTCCCCATTCTGCAGATGAGA 0: 1
1: 5
2: 40
3: 173
4: 729
Right 1145000664 17:19302308-19302330 TGAGAAAACAGGCACTGAGAAGG 0: 1
1: 2
2: 19
3: 104
4: 715
1145000659_1145000665 7 Left 1145000659 17:19302290-19302312 CCGTCCCCATTCTGCAGATGAGA 0: 1
1: 5
2: 40
3: 173
4: 729
Right 1145000665 17:19302320-19302342 CACTGAGAAGGTAATCACCTAGG 0: 1
1: 0
2: 0
3: 8
4: 130
1145000659_1145000668 14 Left 1145000659 17:19302290-19302312 CCGTCCCCATTCTGCAGATGAGA 0: 1
1: 5
2: 40
3: 173
4: 729
Right 1145000668 17:19302327-19302349 AAGGTAATCACCTAGGCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
1145000659_1145000671 29 Left 1145000659 17:19302290-19302312 CCGTCCCCATTCTGCAGATGAGA 0: 1
1: 5
2: 40
3: 173
4: 729
Right 1145000671 17:19302342-19302364 GCCAGGGGTCCCCAACCTCCGGG 0: 1
1: 18
2: 156
3: 545
4: 1290
1145000659_1145000666 12 Left 1145000659 17:19302290-19302312 CCGTCCCCATTCTGCAGATGAGA 0: 1
1: 5
2: 40
3: 173
4: 729
Right 1145000666 17:19302325-19302347 AGAAGGTAATCACCTAGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145000659 Original CRISPR TCTCATCTGCAGAATGGGGA CGG (reversed) Intronic
901021734 1:6259563-6259585 TCCCATCTGCAGTGTGGGGACGG - Intronic
901636079 1:10670808-10670830 TCACAGCTGAAGGATGGGGAAGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901722489 1:11210813-11210835 GCTCATCTGCAGAATTGTCAAGG - Exonic
901761705 1:11476233-11476255 TCTCATCTATAAAGTGGGGATGG - Intergenic
901776319 1:11562884-11562906 TCTCATCTGTAAAATGGGAGTGG + Intergenic
901836063 1:11925144-11925166 TCACCTCTGCAGACTTGGGAGGG + Intronic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902699390 1:18161307-18161329 GCTCCTCTGCGGCATGGGGATGG - Intronic
902759659 1:18572885-18572907 GTTTCTCTGCAGAATGGGGAGGG - Intergenic
902892048 1:19451602-19451624 TCCCATCTGCAGGGTGGGGATGG - Intronic
903040993 1:20530438-20530460 TCTCTTCTGCAATATGGGGCTGG + Intergenic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903542882 1:24106863-24106885 TCTCATCTGTAAAATTGGGCTGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903825214 1:26139885-26139907 TCTCATCTGCAAACTGGGAGAGG - Intergenic
903857795 1:26346844-26346866 TCTCATCTGTGAAATGGGCATGG + Intronic
903882646 1:26522053-26522075 CCTCATCTGAGGAATGGGAATGG - Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904316039 1:29664257-29664279 TCTCATCTGATAAATGGGGGTGG + Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904611084 1:31726742-31726764 TCACATCTGTGAAATGGGGATGG - Intergenic
904790673 1:33018094-33018116 TCTCATCCACAAAATTGGGATGG + Intronic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904856262 1:33500246-33500268 ACTCAGCTGCAGCATGGGGTGGG - Intergenic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905392774 1:37648522-37648544 TCTCATCAGCAAAATGGAAATGG - Intergenic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905520574 1:38596392-38596414 TCTCATCTATAGTATGGGGTCGG + Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906095907 1:43223797-43223819 TCTCATATGGAGAATGGGCCTGG + Intronic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
906543356 1:46604787-46604809 TCGCAGCTGCAGACTTGGGAAGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906646247 1:47477570-47477592 TCTCATCTGCAAGATGGTGTGGG - Intergenic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
907046435 1:51302860-51302882 TCTCATCTGTGAAATGGGGGTGG - Intronic
907457744 1:54586216-54586238 TCTCATCTGCAGAATGGATGGGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908029826 1:59987416-59987438 TCTCACCTGTACAATGGGCATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909378957 1:74974981-74975003 ACTCATCTCCAGATTTGGGATGG - Intergenic
910226753 1:84943739-84943761 TCCCACCTACAAAATGGGGAGGG + Intronic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912254862 1:108048303-108048325 TCTCCACTGGAGATTGGGGAGGG - Intergenic
912331418 1:108823388-108823410 TTTCATCTAAAGAATGGGGCTGG + Exonic
912466584 1:109878876-109878898 TCTCTTCTGTAAAATGGGAAGGG - Intergenic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913451537 1:118996103-118996125 TCTCATGTGTAAAATGGGGCCGG - Intergenic
915604559 1:156942401-156942423 TCTAATCTGCCTAATGGTGAAGG + Intronic
915627453 1:157124100-157124122 TCTCAGCTGCATAGTTGGGACGG - Exonic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916582666 1:166122702-166122724 TCTTAGCTGCCAAATGGGGATGG + Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922350772 1:224733211-224733233 TCTCATCGGTGAAATGGGGATGG - Intronic
924384758 1:243490590-243490612 TCTCCTCTGCACAGTGGGCATGG + Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1063497906 10:6527067-6527089 TCCCATCTTGTGAATGGGGATGG - Intronic
1063712084 10:8489417-8489439 TCTCATATGCAGTGTGAGGATGG + Intergenic
1064281189 10:13953027-13953049 TCTCTTCTGTAGGATGAGGATGG + Intronic
1065410083 10:25416488-25416510 TCTCATTTTGAGGATGGGGATGG - Intronic
1065963403 10:30752399-30752421 TTTCATCTGCAGAATGACCAAGG - Intergenic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1066291222 10:34016110-34016132 TCTCATCTTCAAAATGGTAATGG - Intergenic
1067688144 10:48480192-48480214 TCTTGTCTTCAGGATGGGGAAGG - Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069831647 10:71285534-71285556 TCTCATCTGCGAAAGGGGCAGGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070545991 10:77452966-77452988 TCTCATCTGGAAAACAGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070726567 10:78795516-78795538 TATCATCTGTAAGATGGGGATGG + Intergenic
1070848348 10:79542108-79542130 TCTGATCTCCAGCCTGGGGAGGG + Intergenic
1070925437 10:80218061-80218083 TCTGATCTCCAGCCTGGGGAGGG - Intergenic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1071782478 10:88861736-88861758 TCTCATCTGTTAAAAGGGGATGG - Intergenic
1071984822 10:91039716-91039738 TCTCATCAGAGCAATGGGGAAGG + Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072075900 10:91973568-91973590 TCTCATCTGCAAAACAGGAATGG - Intronic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072202525 10:93173778-93173800 TCTCATCTATAAAATGGAGATGG + Intergenic
1072244486 10:93530461-93530483 TCTCATCTGAAAAATGGTGCTGG - Intergenic
1072618965 10:97067478-97067500 TCTCCTTTGTATAATGGGGATGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073569389 10:104563731-104563753 TCTCTGCTGATGAATGGGGATGG + Intergenic
1073919596 10:108443614-108443636 TCTCACCTGTAGAATGGCCATGG + Intergenic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074726748 10:116318870-116318892 TCTAATCTCCTTAATGGGGAAGG + Intergenic
1074760543 10:116664420-116664442 TCTCTTCTGCGAAATGAGGAGGG - Intronic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075672505 10:124272159-124272181 TTTCATCTGGATAAAGGGGAGGG + Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1075823741 10:125335974-125335996 TGTCATCTGCTGTATGTGGAAGG + Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1077735913 11:4790598-4790620 TCTCTTCTCCAGAATGAGGGTGG + Intronic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079307780 11:19338910-19338932 CCTCATCTGCAGAATGGCTGTGG - Intergenic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080752587 11:35164693-35164715 TCTCCTCTGCAGAGTGAGCAAGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1080913083 11:36625406-36625428 TCTTATCTGTAGAGTGGTGAGGG - Intronic
1081617059 11:44597336-44597358 TCCCATCTGGGGATTGGGGAAGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081679657 11:44992709-44992731 TCTCATCTGTAAAATAGGGTTGG + Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1082641186 11:55663551-55663573 TCTCATCTGCAGTATAAGGATGG - Intergenic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083622857 11:64057536-64057558 TCTCATCTGTAAAATGGGCGTGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084102206 11:66957264-66957286 TCTCAGCTGGAGAACGGGTAAGG + Intronic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1084942182 11:72618702-72618724 TCTCATCTGAAAAATGGAGGTGG - Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085640160 11:78188441-78188463 TCCCATCTGTGAAATGGGGATGG - Intronic
1085740056 11:79070720-79070742 TCTCATCTGTCAGATGGGGATGG - Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087269406 11:96096453-96096475 TCTCATCTGCAAAAGCGGGGAGG - Intronic
1087706102 11:101493626-101493648 TTTCATGTGCAAAATGGGAACGG - Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088607053 11:111541881-111541903 TCTCATTTGCAGGAAGGCGAAGG - Intronic
1088824058 11:113478750-113478772 TCTCATCTGAAAGGTGGGGAAGG + Intergenic
1088890319 11:114038882-114038904 TCTCATCTGTAAAATGGAGCTGG - Intergenic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091328912 11:134715038-134715060 TCAGATCAGCAGAATGGAGAGGG + Intergenic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091836356 12:3588820-3588842 AGGCATCTTCAGAATGGGGAAGG + Intronic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092954026 12:13532765-13532787 TTTCATAGGGAGAATGGGGAGGG + Intergenic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096526274 12:52212109-52212131 TCTCATCTGAAGAATAGAGTGGG + Intergenic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098890544 12:76006125-76006147 TCTCATCTTCAGAATAGGGATGG - Intergenic
1099182894 12:79487939-79487961 TCACTTATGCAGAATGGGAATGG + Intergenic
1100361910 12:93886963-93886985 TCTCTTCTGCAGAATCAGAATGG - Intronic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100367683 12:93936630-93936652 TCTCATCTGTAAGATGGAGATGG - Intergenic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG + Intergenic
1101438491 12:104684433-104684455 TATCATCTGTAAAAAGGGGATGG + Intronic
1101593413 12:106141853-106141875 TCTAATCTGCAAAGTGGCGATGG + Intergenic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1101841579 12:108331249-108331271 TCCCATCTGTGAAATGGGGATGG - Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102004026 12:109577439-109577461 TCCCATATGCCGTATGGGGATGG + Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102560225 12:113756789-113756811 TCCCATCTGTAAAATGGGGCTGG - Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103079358 12:118011089-118011111 TCACATCTGTAAAATGGGCAGGG - Intergenic
1103140535 12:118544280-118544302 TCTCATCTGTAATATGGGGCTGG - Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103535458 12:121630639-121630661 TCTCATCTGCAGATCAGAGAGGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1104814518 12:131638072-131638094 TCTCTTTTGCAGCATGGGGTAGG + Intergenic
1105916855 13:24924870-24924892 TCTCATCTGCAAAACAGGGGTGG + Intergenic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106154698 13:27143292-27143314 ACTCATTTGCAGCATGGGTAGGG + Intronic
1106327922 13:28711902-28711924 TCTCATCTGTAAAATGGGCGTGG - Intronic
1106974778 13:35196613-35196635 TTTCATGTACATAATGGGGAAGG + Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109055560 13:57543755-57543777 TATCATCTGCAGAATGAAGCAGG - Intergenic
1111192617 13:84830456-84830478 TTTCACCTGAAGAATGGTGAGGG + Intergenic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112262757 13:97892419-97892441 TCTCATCTGTAAAATGGATATGG - Intergenic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112356709 13:98679529-98679551 TCTCCTCTGTGGAATGGGAATGG + Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114738641 14:25070152-25070174 TCTCATCTGGAGTCTGGGGGTGG + Intergenic
1115301622 14:31892100-31892122 TCTAAACTTCAGAATGAGGAGGG + Intergenic
1115402086 14:32973098-32973120 TGTCATCTAGAGAATGGGAATGG + Intronic
1115482132 14:33870917-33870939 TCTCATCTGCCAATTGGGGGTGG - Intergenic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116419009 14:44711749-44711771 TCTCATCTGTAGCATAAGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116970336 14:51058312-51058334 TCACATCTACAGAATGGAAAAGG + Intronic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118837927 14:69489702-69489724 TCTCATCTATAGAGTGGGAATGG + Intronic
1118920752 14:70147742-70147764 TCTTATCTGAAGCATGGGGGTGG - Intronic
1118948864 14:70415957-70415979 TATCATCTCTAAAATGGGGATGG - Intronic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120319349 14:82939712-82939734 TCTCATCACTAAAATGGGGATGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1120719441 14:87874459-87874481 TCTTATCTACAAAATGGGGGTGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121907560 14:97760965-97760987 TCTCTTCTGGGAAATGGGGATGG + Intronic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124038547 15:26079294-26079316 GGTCCTCTGGAGAATGGGGAAGG - Intergenic
1124223179 15:27867050-27867072 TCTCAACTGCACACTGGGAATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124356278 15:28997106-28997128 CCTCATCAGCAGAACAGGGATGG - Intronic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124681002 15:31730744-31730766 TCTCATCTCCAACATGGGGGCGG + Intronic
1124689135 15:31807185-31807207 TTTCACCTGCAAAATGGGAACGG - Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1125754399 15:42053121-42053143 TCTCACCTGCACAGTGGGGTGGG - Intergenic
1126276668 15:46891695-46891717 TCTCATCTTCAGAACAGGGTGGG + Intergenic
1127060403 15:55177037-55177059 TCTCATCTGCACAATAAGAAGGG + Intergenic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127414863 15:58748889-58748911 GCCCCTCTGCAGAATGGGGTCGG + Intronic
1128148664 15:65347371-65347393 TCTCATCTGTAAAATGGGAGTGG + Intronic
1128186227 15:65645418-65645440 TCTCATCTGCAGATAGGTCAGGG + Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128562438 15:68677700-68677722 TTTTATCTGCAGAATGGACAGGG - Intronic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128904695 15:71456522-71456544 TCCCATCTGTGAAATGGGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129170418 15:73804179-73804201 TGACATCTGCAGAATGGGTGTGG + Intergenic
1129952169 15:79601499-79601521 TCTCCTCTGCAGCCTGGGGAGGG - Intergenic
1130100135 15:80887171-80887193 TCTCTTCTTCTTAATGGGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1130393475 15:83480405-83480427 TCTCATCTGTGAAATTGGGATGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130862170 15:87900831-87900853 TCTCATCTGCATAATTGGTAGGG + Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131586958 15:93705606-93705628 TCTCATTTGCATAATGCAGATGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132307842 15:100830565-100830587 TCTCAGCTGGAGATCGGGGAGGG - Intergenic
1132343348 15:101091772-101091794 TCCCATGTGCACAATGGGGATGG - Intergenic
1132464207 16:70299-70321 TCCCACCTGCAGCCTGGGGAGGG - Intronic
1133296171 16:4753540-4753562 CCCCATCTGCAGGATGGAGATGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133598743 16:7318526-7318548 TCTCATCTGTGAGATGGGGATGG + Intronic
1133683234 16:8140644-8140666 TCTCATCTGTCAAATGGGTAGGG + Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133985443 16:10664815-10664837 TCTCATCTGCTGATGTGGGAGGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134100655 16:11449348-11449370 TCTCCTCTTCAGTTTGGGGAGGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1134781032 16:16895718-16895740 TCTCATCTGTGGAATGGCGGCGG - Intergenic
1135514419 16:23118135-23118157 TCTTTTCTGCAAAATGGGAATGG + Intronic
1135797841 16:25462633-25462655 TGTCATCTGCACAGTGGGTAGGG + Intergenic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137584579 16:49656855-49656877 TCTCATCTATAAAATGGGGCTGG - Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138929111 16:61630808-61630830 TCTCTTCTGCATAATGCTGATGG + Intergenic
1139223202 16:65205955-65205977 TCTCACTTGCTGGATGGGGAGGG + Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139658250 16:68402258-68402280 TCTCCTCTATAAAATGGGGAAGG + Intronic
1139662121 16:68428420-68428442 GCAAATCTGCAGAATGGGGCAGG - Intronic
1140232456 16:73128870-73128892 TCTCATCTATATAACGGGGATGG + Intronic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141646985 16:85372849-85372871 TCTCATCTGCAACAAGGGGGAGG - Intergenic
1141760838 16:86027441-86027463 GCTCATCTGTAGTACGGGGAGGG - Intergenic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142401819 16:89862899-89862921 TCTCTTCTGTAAAATGGGGCTGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1143030507 17:3964568-3964590 TCCCCTCTGCAGAATGGGCGGGG - Intergenic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144602864 17:16633906-16633928 TCTCATTTGGAGAATGGGAAAGG - Exonic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144889811 17:18488160-18488182 TGTCATCTGTAGAATGAGCATGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145218002 17:21066634-21066656 GCTGATCTCCAGAATGGAGATGG + Intergenic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145973421 17:28970285-28970307 TCTCATCTGTAAAGTAGGGATGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146558298 17:33846474-33846496 TCTGATCTGCAGAGTGGGATGGG + Intronic
1146579708 17:34025982-34026004 TCTCATCTGTGAAATGGGTATGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147655745 17:42089760-42089782 TCTCAGCAGCAGAATGTGTACGG + Intergenic
1147817637 17:43221520-43221542 GCTCATCTGCATTTTGGGGATGG + Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148897527 17:50847938-50847960 TCTGTTCTGCAGGATGGGGGTGG + Intergenic
1148988610 17:51646217-51646239 TCCCATCTGTAAACTGGGGATGG + Intronic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149081314 17:52660991-52661013 TCTCATTTGGATATTGGGGATGG + Intergenic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1150324823 17:64248496-64248518 TGTCATCTGCTGAATGCTGAAGG + Intronic
1151224146 17:72636278-72636300 TCTCATCAGCACAGTGGGGCTGG - Intergenic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152389279 17:79993103-79993125 TCCCCTCTGCACAATGGGGCTGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153517672 18:5919425-5919447 TTTCATCTGCAGAATATTGAAGG - Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154049026 18:10935771-10935793 TCTCATCTGCAGCATGACCACGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154486689 18:14877618-14877640 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156517631 18:37694503-37694525 TTTCGTGTGCAGAATGGGAAAGG + Intergenic
1156863403 18:41863889-41863911 ACTCATCTGCAGCATGTGGCAGG + Intergenic
1157156180 18:45268712-45268734 TTTCATCTGTTGAATGGAGAAGG + Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158846081 18:61444168-61444190 TCTATGGTGCAGAATGGGGAGGG - Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159464248 18:68760060-68760082 TCACACCTGTAGAATGGAGAAGG - Intronic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161658257 19:5529451-5529473 TCTCATCAGAAGGATGGGGTGGG + Intergenic
1162198823 19:9006731-9006753 TCTCATCTATAAAACGGGGATGG + Intergenic
1162351530 19:10153002-10153024 ACCCATCTGGAGAATGGGAAGGG - Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163584776 19:18157632-18157654 ATCAATCTGCAGAATGGGGAGGG - Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165313933 19:35043507-35043529 TCTCATCTGTGAAATGGAGAGGG + Intronic
1165407736 19:35641413-35641435 TCTCATTTGATGAAGGGGGAAGG - Intergenic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166108454 19:40609128-40609150 TCTCATTGGTAAAATGGGGATGG + Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167660345 19:50792452-50792474 TCCCATCTGCACAGTGGGGATGG + Intronic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168377034 19:55888722-55888744 GCACATCTGCAGAATAGAGAAGG + Intergenic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925712051 2:6750609-6750631 CCTTATCTGCAGAATAGGCAAGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926105364 2:10146437-10146459 TCTGCTCTGCGGAATAGGGAAGG + Intronic
926147120 2:10403404-10403426 TTTCAACTGCAGAATGGAGCTGG - Intronic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926297538 2:11579561-11579583 TCTCATCTAGAAAATGGGGGTGG - Intronic
926389836 2:12378148-12378170 TTTCATCTGCAAAATAGAGATGG + Intergenic
926404120 2:12532536-12532558 TCTCATTTGCAAAAAGGGAATGG + Intergenic
926684603 2:15689417-15689439 GCCCATCTCCAGAATGGCGATGG - Intergenic
927095276 2:19743625-19743647 TCTGCTCTGTAGAATGGAGATGG - Intergenic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927279378 2:21290576-21290598 TCTTATCTTCAGAATAGGCAAGG - Intergenic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
929868341 2:45737089-45737111 TCTCCCCTGCAGCATGGGGTTGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932748998 2:74359146-74359168 TGTCAGCTGAGGAATGGGGATGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932909992 2:75796191-75796213 TCTCATCTGTAAAATAGGAATGG - Intergenic
933536260 2:83578649-83578671 CCACATCTGAAGAATGGGCAAGG + Intergenic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937228675 2:120384336-120384358 TTTCATGTGCAAAATGGGGCTGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937310471 2:120899684-120899706 TCACCTCTGCAGAATAGGAATGG + Intronic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
938064428 2:128273401-128273423 TCACATCTGCAGAAAGGGGCAGG - Intronic
938628273 2:133135735-133135757 TTTCCTCTGCATACTGGGGACGG + Intronic
938768829 2:134482648-134482670 TCTCATCTGCTGGTTGGGGGTGG - Intronic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
940019495 2:149142075-149142097 TCTAATATGCAGCATGGGCAGGG - Intronic
940144842 2:150534800-150534822 TCTCATCTATAAAATGGGTAGGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940899523 2:159113654-159113676 TCTCACCTGGAGAATAGAGAAGG + Intronic
941215939 2:162709117-162709139 TATCATCTGCAAAATAGAGACGG + Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942062482 2:172240542-172240564 TTCCATCAGGAGAATGGGGAAGG + Intergenic
943600521 2:189914794-189914816 TCTCATCTATAAAATGGGGCAGG - Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
946009863 2:216555663-216555685 TTGCATCTGCAGCCTGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
948663448 2:239520512-239520534 TCAAATCTGCAGGAAGGGGAAGG - Intergenic
1168830635 20:843610-843632 TCTCATCTGTAAAATGGAGGGGG - Intronic
1169152962 20:3304976-3304998 TCTCAGCTGAAGACTGGTGAAGG + Intronic
1170159890 20:13300090-13300112 TCTCTTCTTCAGACTGGGTAGGG + Exonic
1170624174 20:18018906-18018928 TCTGTGCAGCAGAATGGGGATGG - Intronic
1170652713 20:18257364-18257386 TCAGATCTGGAGAGTGGGGAGGG - Intergenic
1170740625 20:19052937-19052959 TCTCATCCATAAAATGGGGATGG + Intergenic
1171490986 20:25516975-25516997 CCTCATCTGAATAATGGGTATGG + Intronic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1172007911 20:31830150-31830172 TCTCAGCTGCCAAATGGGAATGG + Intronic
1172101411 20:32485754-32485776 TCTCATTTTCAGAGTGAGGATGG - Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172126132 20:32626435-32626457 TCTCCTCTGTAAGATGGGGATGG - Intergenic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172943741 20:38672594-38672616 TCTAAACTGCAGTTTGGGGAGGG + Intergenic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173605135 20:44326566-44326588 TCCCATCTGTTAAATGGGGATGG - Intergenic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1173950386 20:46988348-46988370 TCTCATCTGGAAAATGGTCACGG - Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174706811 20:52664751-52664773 TCTCATCTGCAAGATGAGGTGGG - Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175229613 20:57465467-57465489 TCTCATCTCCAAAATGGTGCAGG + Intergenic
1175243536 20:57567407-57567429 TCTCAGCTCCTTAATGGGGAAGG - Exonic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175949935 20:62577971-62577993 TGTCATCTGCAGAATGGATGCGG + Intergenic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176794613 21:13361781-13361803 TCTCATCTGTTCAGTGGGGATGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178412819 21:32379664-32379686 TCTCATCTGTAAAATGGGTGTGG - Intronic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1179094486 21:38299998-38300020 TGTCATGGGCAGAATGAGGAAGG - Exonic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179548806 21:42130046-42130068 TTTCATCTGTAGCATGGGTATGG - Intronic
1180278514 22:10669153-10669175 TCTCATTGGAAGAAGGGGGAAGG + Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181945446 22:26513271-26513293 TCTCTTCTGCAAAATGGTTAAGG + Intergenic
1181997758 22:26896240-26896262 TCTCATGTGTAAAATGGGAATGG - Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182543419 22:31058236-31058258 TCCCATCTGAACCATGGGGAAGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183346174 22:37309618-37309640 TCTCCCCAGCGGAATGGGGAGGG + Intronic
1183430974 22:37765593-37765615 TCTCCTCTGGAGGCTGGGGAAGG + Intronic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1183697022 22:39429223-39429245 TCTCATCAGCTGGGTGGGGACGG - Intronic
1183697553 22:39431711-39431733 TCTCACCTGCAGAACAGAGATGG - Exonic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184642249 22:45878922-45878944 TCTCATCTGTGGAATGGGCCGGG + Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949426779 3:3926138-3926160 ACACATCTATAGAATGGGGAAGG - Intronic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950438632 3:12994633-12994655 TCCCATCTGCGAACTGGGGACGG - Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951308745 3:21098557-21098579 GCTCATCTGTGGAATGGGAATGG - Intergenic
951378536 3:21954092-21954114 TCTTATCTTCCAAATGGGGATGG - Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952352684 3:32555649-32555671 ACTCAGCTGCAGGATGGGAATGG - Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953716606 3:45321382-45321404 TCTCATCAGCACGATGGGGAGGG + Intergenic
953800548 3:46019497-46019519 TCTAATTTGCAGATTAGGGAGGG + Exonic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
954388269 3:50255663-50255685 TCCCACCTGTAGAATGGGAATGG - Intronic
954447620 3:50555182-50555204 TCAAATCTGCAGACAGGGGAGGG - Intergenic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955210994 3:56940874-56940896 TCTTATCTGCAAAATAGGTATGG - Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
955772488 3:62399619-62399641 TCTCATCTCCATGATGGGGAGGG + Intronic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956754171 3:72368877-72368899 TCCCAACTGCAGAAGAGGGAAGG - Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957569180 3:81924488-81924510 TCTTATCTACAAATTGGGGAGGG - Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959917505 3:111832464-111832486 TTTCCTCTGGGGAATGGGGATGG - Intronic
961360619 3:126364965-126364987 TCTCATGAACAGAGTGGGGAGGG + Intergenic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
965184865 3:165449852-165449874 TTTGCTCTGCAGAATTGGGATGG + Intergenic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
965772600 3:172196577-172196599 TCTCATCTGTAAAATGGAGGTGG + Intronic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967316953 3:188158693-188158715 TCTCATCTGCAAAATGAGACTGG - Intronic
967834369 3:193948549-193948571 TCTCATCTGGAAAATGGCAATGG + Intergenic
968609093 4:1549066-1549088 TCTCACCCGCAGAGCGGGGAGGG - Intergenic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
968629990 4:1645359-1645381 TCTCTTCTGCAGGGTTGGGAGGG - Intronic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968890593 4:3366605-3366627 TCTCAACAGCAGAAAGGAGACGG - Intronic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969226045 4:5798956-5798978 TCTCCCTCGCAGAATGGGGAGGG + Intronic
969267088 4:6071584-6071606 TCCCATTTGCAGACTTGGGAAGG - Intronic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970006051 4:11411933-11411955 TCCCATCTGAAATATGGGGATGG + Intronic
970248578 4:14090492-14090514 TCTCATCTACATGATAGGGATGG - Intergenic
970383482 4:15532030-15532052 TCACATCTGTAAAATGGGTATGG - Intronic
970452332 4:16182323-16182345 TCTCATCTTCAGAATAGTCAGGG + Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970599453 4:17629359-17629381 CCTCATCTGCAGAATCCAGATGG + Exonic
971181688 4:24334272-24334294 TCTCATCTATAAAATGGGAAAGG - Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
972647070 4:40979059-40979081 TCTCATCTGCACAATGAGTTCGG + Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973148477 4:46859460-46859482 TCTCATCTGGAAAATGGTGCTGG + Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973644192 4:52933570-52933592 TTCCTTCTGCAGGATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973680861 4:53317797-53317819 TCTCCTCTCCTAAATGGGGATGG + Intronic
974026028 4:56733909-56733931 TCCCATCTACAGAAGGGTGATGG - Intergenic
975193078 4:71489427-71489449 TCCCATCTGCAACATCGGGATGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
980074019 4:128274909-128274931 TTTTATCTGCCAAATGGGGAAGG - Intronic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
982097836 4:151939144-151939166 TCTCATCTGCGTAATGGGAAAGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985119976 4:186630714-186630736 TCTCATCTACAAAGTGGGGGTGG - Intronic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
985821381 5:2163195-2163217 TCTCATCTCTAACATGGGGATGG + Intergenic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
987072776 5:14353593-14353615 TCTCATCTATAAAATGGGCATGG - Intronic
987345639 5:16976399-16976421 TATCATCTTCACAATGGGGTTGG + Intergenic
987622076 5:20347409-20347431 TCACTACTCCAGAATGGGGAAGG + Intronic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991490188 5:67175163-67175185 TCTCATCTATAAAATGGGAATGG - Intergenic
991986819 5:72296883-72296905 TCTCATTTTCAGCATGGGTACGG - Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993423814 5:87737052-87737074 TGCCATCTGAAGAAAGGGGATGG - Intergenic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995123184 5:108556767-108556789 TCTCATCTGAGGGAAGGGGAGGG + Intergenic
995234677 5:109814174-109814196 TTATATCTTCAGAATGGGGAGGG - Intronic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
996237221 5:121146098-121146120 TATCATTTGAGGAATGGGGATGG + Intergenic
996815103 5:127565805-127565827 TCTCATCTACAAAGTGGGTATGG - Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997384040 5:133458634-133458656 TCCCATCTGTGGACTGGGGATGG + Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997778995 5:136638348-136638370 TTTCATCTGTAGACTGGAGATGG - Intergenic
997880213 5:137582615-137582637 TCTCATCTATAAAATGGGAATGG - Intronic
998078271 5:139253968-139253990 TCTCATGAGCAGACTGGGGTAGG - Intronic
998132623 5:139659097-139659119 GCCCATCTGCAGAATGGAGGTGG + Intronic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999587678 5:153108926-153108948 TGACATCTGAAGAATGGAGAAGG - Intergenic
999608969 5:153349087-153349109 TCTCATCTGTGGAATGGGATGGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000247900 5:159464634-159464656 TCGAACCTGCAGAATGGTGATGG + Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001165816 5:169365890-169365912 TCTCATTTGAGAAATGGGGAGGG - Intergenic
1001301674 5:170538081-170538103 TCTCATCTTTAAAATGGGAAAGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001852269 5:174979969-174979991 TCCCACCTTCAGGATGGGGAGGG + Intergenic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002026498 5:176399443-176399465 TCTCATTTGAAAAATGGGGCTGG + Intronic
1002105909 5:176879392-176879414 TATCTTCTGCCGAATGAGGAAGG - Exonic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002881387 6:1255470-1255492 TTTCATGTGCAGAATGGTGGTGG - Intergenic
1003458864 6:6310659-6310681 TCTCATCTGCAAAATGAAGTTGG + Intronic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1004234942 6:13866803-13866825 TCCCATCTGCAAAATGGGAGTGG + Intergenic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1006387313 6:33738575-33738597 TCTCATCTGTAAAACGGGGCTGG - Intronic
1006915370 6:37590468-37590490 TGTCATCTAGAAAATGGGGATGG + Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007416481 6:41694229-41694251 TCTCATCTGCACAATGGACTTGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008010483 6:46461897-46461919 TCTTGACTGCAGAATGGAGAAGG + Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012952317 6:105531480-105531502 TCTCATCTATAAAATGGGAATGG - Intergenic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015103437 6:129507957-129507979 TCTCATCTCCAGAAACTGGAAGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017444943 6:154499141-154499163 TCCTTTCTGCAGAATAGGGAGGG - Intronic
1018604669 6:165584507-165584529 TGTCATCTGCAGAATGGCACTGG - Intronic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1020026689 7:4904698-4904720 TCTCAGTTGCTAAATGGGGAAGG - Intergenic
1020030450 7:4929233-4929255 TCTCATCTGTCGAATGGGCTCGG - Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022270805 7:28805790-28805812 TCCCATCTGTAAAATGGGGCTGG + Intronic
1022317725 7:29261185-29261207 ACTCTTTTACAGAATGGGGAAGG + Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023817499 7:43961890-43961912 TCTGCTCTGCAGAATGGGTTTGG + Intergenic
1024336864 7:48217622-48217644 TCTCATCTTCAAACTGAGGAAGG + Intronic
1026020105 7:66699388-66699410 TCTCATCTGTAAAATGGGAGTGG + Intronic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1026840336 7:73667453-73667475 TCTCTTCTGTAAAATGGGGTTGG - Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027109220 7:75423789-75423811 TCTCATCTGACAAATGAGGAAGG + Intronic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1028367534 7:90050993-90051015 TCTCAACTTCAGATGGGGGAGGG + Intergenic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029585633 7:101468977-101468999 TCTCATCTGTGAAATGGGGTTGG + Intronic
1029595093 7:101533469-101533491 TCCCACCTCCAGAATGGGGCTGG + Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1031008139 7:116497856-116497878 TCTCATCAGGAGAATGGACAAGG + Intronic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1031697895 7:124882946-124882968 TTTCATCTAAAGAATGGAGATGG - Intronic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033516094 7:142108102-142108124 TCTCATGTGCAAATTTGGGAGGG - Intergenic
1033647354 7:143315758-143315780 TCTCTTCTTCAGGATGCGGAAGG - Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034329537 7:150270414-150270436 CCTTCTCGGCAGAATGGGGATGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034668519 7:152839447-152839469 CCTTCTCGGCAGAATGGGGATGG + Intronic
1035309371 7:157955422-157955444 TCTCATCAGCAGCCAGGGGAGGG + Intronic
1035625472 8:1067555-1067577 TCCCATCTGGAAAATGGGCATGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037272612 8:17146209-17146231 TCTCATCTGTAGCATGAGAAAGG + Intergenic
1037748322 8:21663593-21663615 TCTCATCTGTCAAATGGAGATGG - Intergenic
1037894703 8:22644190-22644212 TTTTATCTCCAGAATGGGAAAGG - Intronic
1037994621 8:23343341-23343363 TCTCATCTGTAAGGTGGGGATGG - Intronic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1038214102 8:25545855-25545877 TCTGATCTTCAGCATGGGGAGGG - Intergenic
1038219965 8:25598046-25598068 TCTCATCTGCAAAATGGACCTGG + Intergenic
1038409294 8:27345616-27345638 TCATATCTGCAGGCTGGGGAAGG - Intronic
1038985108 8:32800666-32800688 TCTCATCTAGAAAATGGGGGGGG - Intergenic
1039180693 8:34862625-34862647 GCTCTTCTGGAGAATGGGGTAGG + Intergenic
1039213849 8:35245717-35245739 TCTCCGCTGCAGAATGTGGTAGG - Intronic
1041984622 8:63907559-63907581 TCTTACCTGCAAAATGGGTATGG - Intergenic
1042224380 8:66504138-66504160 TCTTCTCTGCACAGTGGGGAGGG - Intronic
1042785729 8:72544914-72544936 TCTCATCAACAGAATGTGAATGG - Intronic
1042944902 8:74144983-74145005 TCTCTTCTGGAGAATGAGAAGGG + Intergenic
1043804003 8:84647927-84647949 TCTCATCTGTAATTTGGGGAAGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1046635317 8:116668988-116669010 TCTCATCTCCATATTGGCGACGG + Intronic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1048256871 8:132911593-132911615 TCTCATCTGCCAAATGGAGCTGG + Intronic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1048609845 8:136010249-136010271 TCTCATCTCCAAAATAAGGACGG + Intergenic
1048973923 8:139660795-139660817 TCCCATCTGGAAAATGGGAATGG - Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049282484 8:141757146-141757168 TCTCAGCAGCACCATGGGGAGGG + Intergenic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1050150442 9:2614506-2614528 TTTCATCTGAAAAATGGGGGTGG - Intergenic
1050276223 9:4003626-4003648 TCAAATGTGCAGAATGGTGATGG - Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051584016 9:18707569-18707591 TCTCATCTGTAAGATGGGGGTGG - Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1053004297 9:34593934-34593956 TCTAGGCTGCAGAATGGGGTGGG - Intergenic
1053138331 9:35665498-35665520 TCCTATCTGGAGAATTGGGACGG + Intronic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1053887620 9:42656395-42656417 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226642 9:62463845-62463867 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1055036835 9:71826588-71826610 TGTCATGTCCAGGATGGGGAGGG + Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056757933 9:89393913-89393935 ACTCATCTGCAAAATGGAAATGG + Intronic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1056944501 9:90983100-90983122 TCCCCTTTGCAGAATGGTGATGG - Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057621026 9:96635211-96635233 TCTTCTCTGCAAAATGGTGATGG + Intergenic
1057691789 9:97292386-97292408 TCTCCTCTGCACAATGGGCGTGG + Intergenic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058279458 9:103094666-103094688 TTTCATTTGCAGAATGGTGTTGG - Intergenic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059434500 9:114267902-114267924 TTCCAACAGCAGAATGGGGAGGG - Intronic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059651475 9:116319679-116319701 TCTCATCTGCAGAATGGACTGGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060238445 9:121883251-121883273 TCTCTTCTGTAAAATGGAGATGG + Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061659454 9:132119126-132119148 TCTCATCTGTAGCATTGAGATGG + Intergenic
1061673057 9:132200033-132200055 GGCCATCTGTAGAATGGGGATGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062360765 9:136186875-136186897 TCTCACCTGCAGTGTGGGGTCGG - Intergenic
1062733745 9:138123125-138123147 TCTCTTCTGCTGTATGTGGAAGG - Exonic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186789759 X:12985525-12985547 TCTCACCTGCCTAATGTGGAAGG + Intergenic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1188001607 X:24987762-24987784 TCCCTTCTGCACACTGGGGAAGG - Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190843665 X:54170472-54170494 TTTCATCTGCAGAAATGGGCTGG - Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1200059652 X:153478603-153478625 TCTCCTCTGTAAAATGGGGTAGG - Intronic
1201408713 Y:13675633-13675655 TCCCACCTGCAGTATGGTGAAGG - Intergenic