ID: 1145002524

View in Genome Browser
Species Human (GRCh38)
Location 17:19315202-19315224
Sequence CCTGTTCACCAGCCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145002524_1145002531 4 Left 1145002524 17:19315202-19315224 CCCTCCTTTGGCTGGTGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1145002531 17:19315229-19315251 TGCCCTGGACCCAGTGTTCTGGG 0: 1
1: 0
2: 2
3: 26
4: 231
1145002524_1145002530 3 Left 1145002524 17:19315202-19315224 CCCTCCTTTGGCTGGTGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1145002530 17:19315228-19315250 GTGCCCTGGACCCAGTGTTCTGG 0: 1
1: 0
2: 2
3: 14
4: 186
1145002524_1145002536 15 Left 1145002524 17:19315202-19315224 CCCTCCTTTGGCTGGTGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1145002536 17:19315240-19315262 CAGTGTTCTGGGCCGAGCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145002524 Original CRISPR CCTGTTCACCAGCCAAAGGA GGG (reversed) Intronic
901480369 1:9520797-9520819 CCTGTGCACCACCCAAAAGGTGG + Intergenic
901946093 1:12705196-12705218 GCATTTCACCAGCCAGAGGAAGG - Intergenic
903019554 1:20384556-20384578 CCAGTCCCCCAGCCACAGGAAGG - Intergenic
903247246 1:22025175-22025197 CCTTTGCACCACTCAAAGGAAGG - Intergenic
907371389 1:54005746-54005768 CCTGTTCCCCACCCATAGGAGGG + Intergenic
908452891 1:64273586-64273608 ACTGTGCACCAGCCGAAGCAGGG + Intergenic
911506905 1:98764111-98764133 TGTGTTCACCATCTAAAGGAAGG + Intergenic
915239054 1:154506913-154506935 CTTGCTCATCAGCAAAAGGAAGG - Intronic
916558383 1:165911940-165911962 CTGGGTCACCAGCCTAAGGAAGG - Intergenic
916789822 1:168115551-168115573 CCAGTTCACAAGCCACAGCAAGG + Intronic
917794995 1:178527015-178527037 GCTGATCTCCAGCCAAAGGTTGG + Intronic
919731489 1:200916204-200916226 CCTCCTCACCACCCCAAGGAGGG - Intergenic
920513328 1:206566617-206566639 ACTGTGCTCCAGCCAACGGAGGG - Intronic
921908589 1:220523527-220523549 CCTGTGCACTAGGAAAAGGAAGG - Intergenic
1063909755 10:10817711-10817733 ACTGTTCATCAGCCAATGAATGG - Intergenic
1064655448 10:17551398-17551420 CCTTTTCACCCGCCCAAGGCAGG + Intergenic
1066126115 10:32344986-32345008 CTTGTTCAGCAGCCAAGGAAGGG - Intronic
1067006101 10:42665286-42665308 ACTGTGCACGAGCCAAAGCAGGG + Intergenic
1067293906 10:44963420-44963442 CCTGTTCGCCAGCAAATGGCAGG - Intronic
1068256180 10:54515148-54515170 ACCGTGCACCAGCCAAAGCAGGG + Intronic
1068333427 10:55602032-55602054 GCCGTGCACCAGCCAAAGCAGGG + Intronic
1069343980 10:67445689-67445711 ACTATTCAGCAGCCAAAGGTAGG + Intronic
1070335446 10:75450844-75450866 CCTGTTCGGCAGCCACAGCAGGG - Intronic
1072453995 10:95560834-95560856 CCTCTGCAGCAGCCAGAGGAAGG - Intronic
1076288047 10:129320615-129320637 GCTGTTCAGCAGTCAAAAGAAGG - Intergenic
1080778364 11:35407423-35407445 CCTGTTCATCTGCTAAGGGAAGG - Intronic
1087451631 11:98330746-98330768 ACTGTGCACGAGCCAAAGCAGGG - Intergenic
1088537623 11:110878325-110878347 TCTACCCACCAGCCAAAGGAAGG - Intergenic
1088935846 11:114399918-114399940 CCTGTTCACAAGCTAAGTGAGGG + Intronic
1089190977 11:116653115-116653137 CCTGAGCACCAGGCATAGGAAGG + Intergenic
1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG + Intronic
1090975171 11:131673769-131673791 TCTGTTCTCCAGCCTCAGGAAGG - Intronic
1091798970 12:3312849-3312871 CCAGCTCACCAGACCAAGGAGGG + Intergenic
1093579306 12:20769109-20769131 ACTGTGCACCAGCCAAAGCAGGG + Intergenic
1093941203 12:25056808-25056830 CCTGTTCAGCAGCCAAGCTAAGG - Intronic
1094063028 12:26334718-26334740 CCAGTTGACCAGGCAAAGGAAGG + Intergenic
1094631349 12:32178441-32178463 CCTGTTCAGCTGCAAAAGGTAGG - Intronic
1094810520 12:34133495-34133517 ACTGTGCATGAGCCAAAGGAGGG + Intergenic
1095773825 12:45990941-45990963 CCTGTAAAACTGCCAAAGGAGGG - Intronic
1096693637 12:53335643-53335665 CCCGTTCCCCAGCCTCAGGATGG - Exonic
1096852799 12:54453019-54453041 ACTGTTCACATTCCAAAGGAAGG + Intergenic
1100598976 12:96096315-96096337 CCTGTTCACCAACCTGAGGTGGG + Intergenic
1101312641 12:103597155-103597177 CTTTTTCCCTAGCCAAAGGAAGG - Intronic
1104794212 12:131505832-131505854 CCTGTGCAGGAGCCAAAGGGAGG + Intergenic
1106330025 13:28731746-28731768 ATTTTTCATCAGCCAAAGGAGGG - Intergenic
1112015497 13:95328033-95328055 TCTGTTTAGAAGCCAAAGGAGGG - Intergenic
1112776920 13:102854228-102854250 CCTGTTCACCATCCTGAGCAGGG + Intronic
1115520601 14:34229457-34229479 CCTGCCCTCCAGCCAAAGGCAGG + Intronic
1117584308 14:57184562-57184584 CATGAACACCAGTCAAAGGATGG - Intergenic
1124407610 15:29405665-29405687 CCTGCTGAGCAGCCAAAGGCAGG - Intronic
1126624842 15:50676714-50676736 GCTGTTCACTAGGCATAGGATGG - Intronic
1129837444 15:78719989-78720011 ACTGTGCACCAGCCGAAGCAGGG + Intronic
1132636932 16:954503-954525 CCAGTCCATCAGCCAGAGGATGG + Exonic
1138206180 16:55126795-55126817 CCTTTTAACCAGCCAGAGGATGG - Intergenic
1138901315 16:61274421-61274443 CCTGCCCTCCAGCCAAAGGCAGG - Intergenic
1141226641 16:82122531-82122553 CCTATTCACAAGCCAAAATATGG - Intergenic
1141996272 16:87638332-87638354 TCTGTTCACCAGCAAAGGGCTGG - Intronic
1145002524 17:19315202-19315224 CCTGTTCACCAGCCAAAGGAGGG - Intronic
1145733251 17:27209710-27209732 CCTGTGCACAGGACAAAGGAAGG + Intergenic
1148208474 17:45794061-45794083 TCTGTCCTCCAGCCAAAGCAGGG + Intronic
1152342776 17:79734338-79734360 CCTGCTCACCAGCCGGTGGAAGG - Intronic
1154213045 18:12396328-12396350 CATTTTCACAAGGCAAAGGATGG - Intergenic
1154295033 18:13140165-13140187 CCTGTTCACCAACCACTGGAAGG - Intergenic
1155346693 18:24864331-24864353 CATGTTCACCAGAGCAAGGATGG - Intergenic
1155947865 18:31876758-31876780 TCTGTTCACCATCCAACTGATGG + Intronic
1156036970 18:32774910-32774932 CCTGTTCAACACCCAAATAAGGG - Intergenic
1156291625 18:35752930-35752952 TCTGTTCTGCAGCCAATGGAGGG - Intergenic
1157647596 18:49292410-49292432 ACTGTTTACCAGAAAAAGGAAGG - Intronic
1158417290 18:57259855-57259877 ACTGTGCACGAGCCAAAGCAGGG + Intergenic
1163638626 19:18449512-18449534 CCTGCTCTCCAGCCACAGCAGGG + Intronic
1163955435 19:20633758-20633780 ACTGTGCACGAGCCAAAGCAGGG - Intronic
1165347339 19:35257235-35257257 CATTTTCACCAGGCAAAGGATGG + Intronic
1166041113 19:40203622-40203644 CCTGCTCATCAGCTAAAGCAGGG + Intronic
1167636822 19:50660097-50660119 CATGTTCAGCTGCCAAAGAAGGG - Intronic
925920505 2:8634584-8634606 CCTGCTCACCAGCAAACGGCTGG + Intergenic
927431758 2:23032081-23032103 CCTGTTGACCAGCCATATGATGG + Intergenic
930411657 2:51032321-51032343 CCCATTCCCCAGCCAAAGGACGG - Exonic
933065552 2:77790272-77790294 GCTTTTCATCAACCAAAGGATGG + Intergenic
936952380 2:117991230-117991252 CCTGTTGCCCAGCCAAAGAATGG - Intronic
941883621 2:170506110-170506132 CCTGTTCACAGGCTCAAGGAAGG - Intronic
944056044 2:195523162-195523184 ACTGTGCACCAGCCAAAGCAGGG + Intergenic
946176793 2:217927271-217927293 CCTGTGTCCCAGCCAAAGGGGGG - Intronic
948830322 2:240595430-240595452 CCCGTGCAACAGCCCAAGGAGGG - Intronic
1169256772 20:4105759-4105781 CCAGTTCACAAGCCAAAGCGAGG + Intergenic
1172662403 20:36576201-36576223 CCTCTTCACCTGTCAAATGAAGG - Intronic
1176644736 21:9339692-9339714 ACTGTGCACTAGCCAAAGCAGGG - Intergenic
1179607134 21:42523937-42523959 TCTGGTCACCAGCTAAAGTAGGG - Intronic
1179973047 21:44846977-44846999 CCTGTTCCCCAGCGAATGCATGG + Intergenic
1180735050 22:18010230-18010252 CCTGTGCACAGGACAAAGGAAGG - Intronic
1181186199 22:21106224-21106246 CCTGTCCACCAACCAATGAAAGG - Intergenic
1181941284 22:26479424-26479446 CCTGTTTCCCAGCCCGAGGAGGG + Intronic
1182615221 22:31583864-31583886 CCTGTGCAGCAGCTAAAGCAAGG - Exonic
1183163575 22:36131166-36131188 ATTATTCACCAGCTAAAGGATGG + Intergenic
1184783891 22:46662584-46662606 CCTGAGCATCAGCCAATGGATGG - Intronic
1185119693 22:48958581-48958603 CCTGCCCAGCAGCCAGAGGAGGG - Intergenic
949530065 3:4947032-4947054 CCTGTCCCCGGGCCAAAGGATGG + Intergenic
952680181 3:36082901-36082923 ACTGTGCACTAGCCAAAGCAGGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961551605 3:127673040-127673062 CCTGTTCGCCAGCTGCAGGAAGG + Exonic
961761295 3:129170371-129170393 CCTCTTCACTGGCCAAAGGTTGG - Exonic
962058340 3:131898371-131898393 CCAGTTCTTCAGCCTAAGGATGG + Intronic
962633249 3:137301322-137301344 CTTTTTCACCAGGTAAAGGAGGG + Intergenic
967568584 3:191000580-191000602 AGTGTTCACCAGCTAAAGAAGGG - Intergenic
1202742155 3_GL000221v1_random:65376-65398 ACTGTGCACTAGCCAAAGCAGGG + Intergenic
969705800 4:8790520-8790542 CCTGGTCCCCAGCAGAAGGAAGG - Intergenic
972854710 4:43093027-43093049 ACTGTGCACCAGCCGAAGCAGGG + Intergenic
974530217 4:63098273-63098295 ACTGTGCACGAGCCAAAGCAGGG - Intergenic
978337630 4:107686808-107686830 CCTGTTCACTAGCCAGAGTTGGG - Intronic
979878758 4:125928236-125928258 CCTTTCCTCAAGCCAAAGGAAGG - Intergenic
988690630 5:33568763-33568785 ACCGTGCACCAGCCAAAGCAGGG + Intronic
990395041 5:55368990-55369012 CCAGTTTATCAGCCAAACGAGGG - Intronic
991997471 5:72402257-72402279 CATGCTCACCTGCAAAAGGAGGG + Intergenic
992747899 5:79837065-79837087 CTTGTTCAGCAGCTAGAGGAGGG + Intergenic
994013479 5:94937054-94937076 GATGTTCACCAGCCAGAGGCTGG + Intronic
994424286 5:99563719-99563741 ACTGTGCACGAGCCAAAGCAGGG - Intergenic
995048262 5:107672907-107672929 CCGGCTCTCCAGCCAAAGGGTGG - Intergenic
995747916 5:115423381-115423403 TCTGTACAGCAGCCAAAGAAGGG + Intergenic
996610284 5:125370940-125370962 CCTGCTCCCCAGCCAAAGGGTGG + Intergenic
996881318 5:128299669-128299691 ACTGTGCACGAGCCAAAGCAGGG - Intronic
999093841 5:148960235-148960257 GGTGTTCACCAGGCTAAGGAAGG + Intronic
999204294 5:149837043-149837065 CCTGGTCACCAGCCACTCGAAGG + Exonic
1001875061 5:175193043-175193065 TCTGGTCACCAGGCAAAGGGAGG + Intergenic
1004528707 6:16433870-16433892 CCTCCTCACCTGCCAAACGAGGG + Intronic
1006106501 6:31720061-31720083 CCTGTTCACCCCACTAAGGAAGG + Intronic
1012246394 6:96930817-96930839 CCTGGTCACAAGGAAAAGGAGGG + Intronic
1013898348 6:115121409-115121431 ACTGTGCACGAGCCAAAGCAGGG + Intergenic
1018361741 6:163077820-163077842 CCTGGTCACTCGCCAGAGGAAGG + Intronic
1018913824 6:168120748-168120770 CCTGTTCATCAGTCAAATGAGGG + Intergenic
1019374779 7:683608-683630 CATGTCCACCACCCACAGGATGG - Intronic
1023550842 7:41368328-41368350 CCTGTCCACCAGCTTGAGGATGG + Intergenic
1024855487 7:53773579-53773601 CCTTTAGACCAGGCAAAGGAAGG - Intergenic
1030750066 7:113221216-113221238 GGTGTTCACCAGGCAAAGGGAGG + Intergenic
1031712824 7:125070472-125070494 GATGTTCACTAGGCAAAGGAGGG + Intergenic
1031976179 7:128095022-128095044 CCTGTCCACCAGCAAGAGGAGGG - Intergenic
1033867839 7:145714003-145714025 CCTCTTCACAAGCAAAAGGAAGG + Intergenic
1038422157 8:27440276-27440298 CTTGTTCTCCAGCCAGAAGAAGG - Exonic
1047220163 8:122912308-122912330 CATGTCCACCAGCCACAGGCTGG + Intronic
1047593612 8:126353593-126353615 CCTGCTCACCAGTCAAGGAAAGG + Intergenic
1048569704 8:135641661-135641683 CCTGTTCATCTGCCAAATCAGGG - Intronic
1048963748 8:139600323-139600345 CTTGGTCAGCAGCCACAGGATGG + Intergenic
1049805704 8:144537879-144537901 CCTGCTCACCAGCCAAGTGCGGG - Intronic
1050698666 9:8310054-8310076 GATGTTCACCATCCAAAGTATGG + Intergenic
1056416672 9:86383446-86383468 ACTGTGCACAAGCCAAAGCAGGG - Intergenic
1057564979 9:96159770-96159792 CCTCATCACCAGCCACTGGATGG + Intergenic
1057896155 9:98910361-98910383 CCATTTCACAGGCCAAAGGAAGG + Intergenic
1057993813 9:99800684-99800706 CCTGTTCTCCAGAAAAAGGGGGG + Intergenic
1060232165 9:121833453-121833475 TCTCTTCACCAGCTTAAGGATGG + Intronic
1060476481 9:123990708-123990730 CCAGATCACCAGCCAGAGAATGG - Intergenic
1061539184 9:131268396-131268418 CCTGCTCACCAGCTGAGGGAGGG + Intronic
1061543439 9:131290383-131290405 GCTCTTCACCAGGCAGAGGATGG - Exonic
1203710784 Un_KI270742v1:95300-95322 ACTGTGCACTAGCCAAAGCAGGG + Intergenic
1185769393 X:2753978-2754000 ACTTTTCATCAGCCAACGGATGG - Intronic
1186214379 X:7283234-7283256 CCAGTCCAGCATCCAAAGGAAGG + Intronic
1187137060 X:16558260-16558282 CCTGGTCACCAGGTAGAGGAGGG - Intergenic
1187680107 X:21759419-21759441 GCTCTTCACCAGACAAATGATGG + Intergenic
1187775962 X:22757602-22757624 CCCTATCACCAGGCAAAGGAAGG + Intergenic
1190587909 X:51965348-51965370 ACCGTGCACCAGCCAAAGCAGGG - Intergenic
1191087769 X:56587497-56587519 ACCGTGCACCAGCCAAAGCAGGG - Intergenic
1191092218 X:56635547-56635569 ACTGTGCACCAGCCAAAGCAGGG - Intergenic
1192568466 X:72182679-72182701 CCTGTTCCCCAGCTAAATGAAGG - Intronic
1193058956 X:77184626-77184648 ACTGTGCATGAGCCAAAGGAGGG + Intergenic
1197262288 X:124332347-124332369 CCTGTTCAGGAGCTAAGGGAAGG + Intronic
1198956438 X:142136603-142136625 TCTGTTCAACAGCCAAAGCCTGG - Intergenic
1200019051 X:153186742-153186764 CCTGTTTACCATTGAAAGGAGGG - Intergenic