ID: 1145002763

View in Genome Browser
Species Human (GRCh38)
Location 17:19317184-19317206
Sequence TAGTGCTGCTTGGAAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145002763_1145002772 18 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002772 17:19317225-19317247 GGCCTTGGGAGGAAATGCTCAGG 0: 1
1: 1
2: 0
3: 24
4: 204
1145002763_1145002775 27 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002775 17:19317234-19317256 AGGAAATGCTCAGGGTTGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 242
1145002763_1145002776 30 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002776 17:19317237-19317259 AAATGCTCAGGGTTGAAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 243
1145002763_1145002768 3 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002768 17:19317210-19317232 GCAACTTGGCCAAGTGGCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 159
1145002763_1145002773 19 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002773 17:19317226-19317248 GCCTTGGGAGGAAATGCTCAGGG 0: 1
1: 0
2: 1
3: 21
4: 168
1145002763_1145002770 7 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002770 17:19317214-19317236 CTTGGCCAAGTGGCCTTGGGAGG 0: 1
1: 0
2: 4
3: 19
4: 215
1145002763_1145002767 -3 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002767 17:19317204-19317226 CTAGGAGCAACTTGGCCAAGTGG 0: 1
1: 0
2: 1
3: 8
4: 135
1145002763_1145002769 4 Left 1145002763 17:19317184-19317206 CCAGTTTTTTCCAAGCAGCACTA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1145002769 17:19317211-19317233 CAACTTGGCCAAGTGGCCTTGGG 0: 1
1: 1
2: 0
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145002763 Original CRISPR TAGTGCTGCTTGGAAAAAAC TGG (reversed) Intronic
900000751 1:13637-13659 TAGTGCCCGTTGGAGAAAACAGG + Intergenic
900020468 1:184156-184178 TAGTGCCCGTTGGAGAAAACGGG + Intergenic
904834475 1:33325985-33326007 TAGTGGAGATTGGAAGAAACAGG + Intronic
905407526 1:37745447-37745469 TAGAGCTGCTTTGAAAAAGTTGG + Intronic
906825849 1:48979044-48979066 TAATTCTGCTTGGCAAAAGCTGG + Intronic
908240897 1:62188269-62188291 TATTTCTGCTGGGAAAAATCTGG - Intergenic
908401879 1:63779192-63779214 TATTGATAGTTGGAAAAAACTGG - Intronic
909917854 1:81342893-81342915 GAGTGCAGTTTGGAAAACACTGG - Intronic
911092619 1:94029862-94029884 TAGAGCTGCTAGGAATAAAAAGG - Intronic
911869572 1:103078218-103078240 TGATGTTGCTTGGAACAAACTGG + Intronic
912114719 1:106391441-106391463 TAGTGGTTCTTTGATAAAACTGG + Intergenic
912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG + Intergenic
912293222 1:108447356-108447378 TTGAGCAGCTTGGAGAAAACTGG - Intronic
912664403 1:111566250-111566272 TAGTGCTGGTTGCAAAAATGAGG + Intronic
912726096 1:112060039-112060061 TAGTGCTGCCAGGTAGAAACTGG + Intergenic
915021700 1:152786052-152786074 TAGGGCTGCTTAGAAACAAAGGG - Intronic
918725859 1:187922711-187922733 TACTGCTGCCTGGCAAAAACTGG - Intergenic
919981625 1:202645523-202645545 TAGTGCTGCTTAGATGAAAAGGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
1066642643 10:37571488-37571510 TAGTACTGCTTGGAAATCTCAGG - Intergenic
1067761990 10:49055358-49055380 TAGAGCTGCTTGGAAAGAAACGG - Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1076611936 10:131731555-131731577 TTGTGCTGAGTGGAAAAAAAGGG - Intergenic
1079631972 11:22688837-22688859 TAGTGCTGCTATGAACATACAGG - Intronic
1079924599 11:26478425-26478447 AAGTGATGCTTGCATAAAACAGG - Intronic
1079940954 11:26679884-26679906 TAGTGATGCTTGGATAGAATGGG + Intronic
1083769088 11:64856413-64856435 TATTGATGCTTGGATAAAGCTGG - Intronic
1088729713 11:112670401-112670423 TACTGCTGGCTGGAAAACACTGG - Intergenic
1091373849 12:13764-13786 TAGTGCCCGTTGGAGAAAACAGG + Intergenic
1091450072 12:567018-567040 CAGTGGTGCTTGGAACAGACTGG + Intronic
1095646263 12:44551674-44551696 TAATGGTGTTTGGAAAAATCAGG + Intronic
1097197436 12:57251055-57251077 TGGTGGTGCTGGGGAAAAACTGG + Exonic
1099466611 12:82995761-82995783 TAGTACTGCTTTCAGAAAACAGG - Intronic
1101988773 12:109467758-109467780 TGGTGCTGCCTGGAAAACACAGG - Intronic
1107668577 13:42718492-42718514 TACTGCTGTTTGGGGAAAACCGG + Intergenic
1108856746 13:54802092-54802114 TACTGCAGCTTGGACAAAAATGG - Intergenic
1112044740 13:95584936-95584958 TAATGTTGCTTAGAAAAAAATGG + Intronic
1114869386 14:26637803-26637825 TACTGCTGATGGGATAAAACAGG + Intergenic
1118648743 14:67867662-67867684 TATTGCTGCCTGAATAAAACTGG + Intronic
1119166662 14:72500366-72500388 CAGTGATGTTAGGAAAAAACAGG + Intronic
1120116781 14:80627126-80627148 TATTGCTTCTTGTAAAAATCAGG - Intronic
1120549540 14:85852530-85852552 CATTGCTGATTGGAAAACACTGG + Intergenic
1124497313 15:30194259-30194281 TAGTGCTGCTTAGATGAAAAGGG + Intergenic
1124746261 15:32344388-32344410 TAGTGCTGCTTAGATGAAAAGGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127113697 15:55702260-55702282 TAGTTCTACTTGGGAAAATCAGG - Intronic
1129084201 15:73071386-73071408 AAGTGCTGATTGAAAAGAACAGG + Intronic
1130370057 15:83277607-83277629 AAGTACTACTTAGAAAAAACTGG - Intronic
1132174594 15:99700676-99700698 CAGGGCTGCTTGGAAAAAAATGG + Intronic
1132452758 15:101977308-101977330 TAGTGCCCGTTGGAGAAAACAGG - Intergenic
1132454139 16:13318-13340 TAGTGCCCGTTGGAGAAAACAGG + Intergenic
1133173942 16:3999560-3999582 GGGTGCTGCTTGGAAGAACCAGG - Intronic
1138651180 16:58462721-58462743 GAGTCCTGCATGGAAAAGACTGG + Intergenic
1141733592 16:85838304-85838326 AAGTGTTTCTTGGAAAAAATAGG + Intergenic
1143847202 17:9781536-9781558 TGGTGCTGTGTGGAAAGAACTGG - Exonic
1144878501 17:18417245-18417267 TGATGCTGCTTGGTAAACACTGG - Intergenic
1144885250 17:18453994-18454016 TGATGCTGCTTGGTAAACACTGG + Intergenic
1145002763 17:19317184-19317206 TAGTGCTGCTTGGAAAAAACTGG - Intronic
1145146967 17:20490382-20490404 TGATGCTGCTTGGTAAACACTGG - Intergenic
1145153733 17:20527142-20527164 TGATGCTGCTTGGTAAACACTGG + Intergenic
1154181482 18:12143195-12143217 TAGTGCTGTTTTCTAAAAACAGG - Intergenic
1154182422 18:12148389-12148411 TAGTGCTGTTTTCTAAAAACAGG + Intergenic
1156912382 18:42426054-42426076 TACTTCTGCTTGAAAAAAGCAGG - Intergenic
1158458235 18:57625899-57625921 TAGTGCAGGATGGAAAAAATGGG + Intergenic
1158945777 18:62445936-62445958 TAGTGTTGCTTGGAAGAAGTAGG + Intergenic
1160244612 18:77146984-77147006 CTGTGCTGTTTGGAGAAAACTGG + Intergenic
925614944 2:5735896-5735918 TATTGATGCTGGGAAAAGACAGG + Intergenic
926873752 2:17452169-17452191 TGGTGCTGCTAGCAAGAAACAGG + Intergenic
928284419 2:29976747-29976769 GAGTGCTGCTTGGAACAATAAGG + Intergenic
928855851 2:35801713-35801735 TAGGGCTGCATGGAAAAAATAGG - Intergenic
929701220 2:44164751-44164773 TTGTGATGCTTGGTAAAGACTGG + Intergenic
930467046 2:51768377-51768399 TAGAGCTGGTTGTTAAAAACAGG - Intergenic
932248121 2:70214962-70214984 TAAAGCTGCCTGGAAAAAAAAGG + Intronic
932445131 2:71776055-71776077 TAGTGCTGCTTGAAGAAGACAGG - Intergenic
933067787 2:77819633-77819655 CAGTGCTGCTAGGAGAAAGCAGG + Intergenic
933862462 2:86483599-86483621 TATTCCTGCTTGGCAATAACAGG + Intronic
935733357 2:106084840-106084862 CAGTGCTGCTTGTTAAAAATGGG - Intergenic
936035929 2:109111253-109111275 AAGTTCTGCTTCGAAAAAAATGG - Intergenic
936039568 2:109139963-109139985 TATAGCTGCTTTAAAAAAACAGG + Intronic
936399367 2:112154007-112154029 TACTCCAGCTTGGAAAAACCTGG + Intronic
936568970 2:113599780-113599802 TAGTGCCCGTTGGAGAAAACGGG - Intergenic
938330173 2:130443306-130443328 GAGTGCTGCTTGGAGAAGCCAGG - Intergenic
938359772 2:130678197-130678219 GAGTGCTGCTTGGAGAAGCCAGG + Intergenic
940688117 2:156879991-156880013 TAATGGTTCTTGGTAAAAACTGG - Intergenic
941276121 2:163492844-163492866 TAGTGCTGCTTGGAGGACACTGG - Intergenic
941909116 2:170745478-170745500 AAGTGCTGCTGGGAAAATCCTGG + Intergenic
942202464 2:173584958-173584980 GAGTGCTGCTTTGAAAAAAGAGG + Intergenic
944311448 2:198237982-198238004 TAGTGCTTATTGGCACAAACTGG - Intronic
946707338 2:222471309-222471331 TAGAGCTGCTGGAACAAAACTGG + Intronic
947279429 2:228433000-228433022 CAGTGCTGCTTGGAATAGAAGGG + Intergenic
948005459 2:234604407-234604429 AAGTGCTGTTTGGAATTAACAGG - Intergenic
1170084739 20:12515979-12516001 TAGAGCTGCCTAGAAAGAACTGG - Intergenic
1171141227 20:22745088-22745110 GAGTGCTGATTGGAACAGACTGG + Intergenic
1173167130 20:40693142-40693164 GAGGGCTCCTTGGAAAAGACAGG - Intergenic
1173381586 20:42549291-42549313 TAGTACTGATTGAAAAAAAAAGG + Intronic
1175106600 20:56619543-56619565 TTGAGCTGATTGGAAATAACTGG + Intergenic
1176892586 21:14336187-14336209 AAGTGCTGCTTCAAAAAATCAGG - Intergenic
1178595923 21:33952175-33952197 TAGTGCTGCTTAGAACATTCTGG + Intergenic
1178930203 21:36811653-36811675 TAGTGCTCCTTGGAGAAATGTGG + Intronic
1179039571 21:37790408-37790430 TATTGCTGCCTGGCAAAAAGAGG - Intronic
1179127804 21:38607142-38607164 AAGTGCTGCTGGAAAATAACTGG + Intronic
1180034805 21:45240679-45240701 AAGTGGTGCTGAGAAAAAACTGG + Intergenic
1182083565 22:27545758-27545780 TTGTGGTGCTGGGGAAAAACAGG - Intergenic
1182433878 22:30317900-30317922 AAGTGCTGGGTGAAAAAAACTGG + Intronic
1184931133 22:47682191-47682213 TTGGGCTGCTTGGAATAGACAGG - Intergenic
1185038601 22:48492421-48492443 TAGTGCAGCTAGGAGGAAACTGG + Intronic
950697860 3:14717511-14717533 AAGTGCTTCTTGTAAAAGACAGG + Intronic
953522584 3:43657146-43657168 TAGAGCTCCTTGGAGAAGACAGG - Intronic
957550940 3:81703599-81703621 TAATTTTGTTTGGAAAAAACTGG + Intronic
958116651 3:89228305-89228327 TAGTGTTCCTTTGAAAAAATTGG + Intronic
959571501 3:107889262-107889284 TAATGCTGCTAGGGAAAGACAGG + Intergenic
963249434 3:143089449-143089471 CAGTGCTGCTTTAAAAAAGCCGG + Intergenic
963316024 3:143759651-143759673 CAGAGCAGCTTGAAAAAAACGGG - Intronic
963644067 3:147891995-147892017 TAGAACTTCTTGGAATAAACAGG + Intergenic
966935797 3:184708354-184708376 TAGTGGTGCATGGCAAAGACAGG - Intergenic
967091697 3:186140029-186140051 AATTTCTGCTTGGAAACAACTGG + Intronic
969582698 4:8074710-8074732 TACTGATGGTTGTAAAAAACTGG + Intronic
970611018 4:17725345-17725367 CAGTGCTGCCTGGGAAAAAGAGG + Intronic
970677395 4:18466756-18466778 TATTGCTGATTAGAAAAAAAGGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
973660416 4:53099658-53099680 TAGAGCTGCTTGTTAAAAACAGG - Intronic
974254780 4:59435688-59435710 TAGTGCTGCTTTGAGAACTCAGG + Intergenic
978144593 4:105357028-105357050 TGGTGCTTCTTGGAGAAAAAAGG - Intergenic
981026895 4:140085613-140085635 CAGAGCTGCTTGGCCAAAACGGG + Intronic
981725301 4:147841217-147841239 TAGCTCTGCTTGGAAACAAAAGG - Intronic
981980232 4:150782900-150782922 TAGTGCTGTGTGGCAAGAACTGG + Intronic
986198401 5:5559161-5559183 TAGAGCTGCTTATAACAAACTGG + Intergenic
987725351 5:21691719-21691741 TACTTCTGCTTTTAAAAAACTGG - Intergenic
988677289 5:33445518-33445540 TGGTACTGGTTGGAAAAATCAGG + Intronic
990172483 5:53068860-53068882 TAAAGCTGCTTGAAAAAAAAAGG + Intronic
990879233 5:60520971-60520993 TAGTGCTGTTTAGAAGAAGCTGG - Intronic
996438986 5:123468175-123468197 TTGTGCTGCTTGGAATAAGGGGG - Intergenic
1003845261 6:10167182-10167204 TAGAGATGCTTGGAAAAATTAGG - Intronic
1003882775 6:10493538-10493560 TAGTGGTGCTTGAAACGAACTGG + Intronic
1003890735 6:10561675-10561697 TAGTGCAGCGAGGGAAAAACAGG - Intronic
1004318053 6:14608914-14608936 TAGTGATGTTTGGAAAATACTGG - Intergenic
1005483345 6:26275556-26275578 TATTCCTGTTTGGAATAAACAGG - Intergenic
1007525670 6:42490448-42490470 CAATGCTGCTGGGAGAAAACAGG - Intergenic
1009687141 6:66976363-66976385 AAGTGCTGCTGGCAAGAAACTGG + Intergenic
1010564716 6:77396259-77396281 AAGTGCTGCTTTGAAAAAAATGG - Intergenic
1010937873 6:81883418-81883440 CAGTGCAGCTAGTAAAAAACAGG - Intergenic
1011251464 6:85376499-85376521 TATTTCTGCATGGCAAAAACTGG + Intergenic
1011642421 6:89428169-89428191 TACTGCTATTTGGAAAAAATTGG - Intergenic
1012336761 6:98069374-98069396 TATTTCTTCTTGGAAAAAAAAGG + Intergenic
1012367967 6:98465321-98465343 CACTGCTGCTTGGAAAAGGCAGG - Intergenic
1012523846 6:100153712-100153734 TAGTGTTGGATGGTAAAAACTGG - Intergenic
1012607337 6:101174185-101174207 TAATACTGCTGGGAAAAAAAGGG - Intergenic
1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG + Intergenic
1015451759 6:133377682-133377704 TACTAGTGCTTGGTAAAAACTGG + Intronic
1016486367 6:144543960-144543982 TACTGCTGCTTTGCAAATACAGG + Intronic
1017314734 6:153017435-153017457 TAGTGTGGCTTGGGAAAATCTGG + Intronic
1017346829 6:153392582-153392604 TGCTGCTGCTTAGAAAAAACTGG - Intergenic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1020247967 7:6445048-6445070 TACAGCTGCTTGGAAAAGTCTGG + Intronic
1020401818 7:7787426-7787448 TAGTACTGCTTTGAAAATATAGG + Intronic
1021834039 7:24649351-24649373 TAGTGATGCTTTTTAAAAACTGG - Intronic
1023696900 7:42856982-42857004 GAGAGCCGCTTGGAAAAAACTGG + Intergenic
1024888811 7:54178429-54178451 GAGTGGTGGTTGGAAACAACTGG - Intergenic
1030402276 7:109067063-109067085 ATGTGCTGCTTAGAAAAAAAGGG + Intergenic
1036800080 8:11784325-11784347 CAGAGCTGCTTGGAAAACACTGG - Intronic
1037080635 8:14781154-14781176 TAGAACTGCTTAGAAAAAAGAGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039953232 8:42188246-42188268 TGGAGCTGCTTTGAAAATACAGG - Intronic
1041331529 8:56731323-56731345 TAATGCTACTGGGAAAAAATAGG - Intergenic
1045247666 8:100457868-100457890 TAGCTCTGCTTGGAGAAAAACGG - Intergenic
1045546031 8:103129412-103129434 AAGAGCTACTTGGAAAAAAATGG - Intergenic
1046058992 8:109113886-109113908 ATGTGCTGCATGGAAGAAACAGG - Intronic
1049106387 8:140616193-140616215 TGGTGCTGCCTGGATAAAGCAGG - Intronic
1049883557 9:13750-13772 TAGTGCCCGTTGGAGAAAACAGG + Intergenic
1050773572 9:9233980-9234002 TAGTGGAGCTTTGAAAAAAAGGG - Intronic
1051719918 9:20026224-20026246 TGGTGCTGATTGTAGAAAACTGG + Intergenic
1053433484 9:38059311-38059333 ACGTGTTGCTTGGAAAACACTGG + Intronic
1055955658 9:81771076-81771098 AAGTGGTGCTTGGCAAGAACAGG + Intergenic
1056810280 9:89758455-89758477 TAGTGCAGCTTTCAAAAAATAGG + Intergenic
1061380394 9:130253165-130253187 TAGAGATGTTTGGAAAAAAAAGG + Intergenic
1189203892 X:39221322-39221344 CAGAGCTGCTTGTGAAAAACTGG + Intergenic
1191751008 X:64542638-64542660 TAGTGTTACTTTGAAAAATCTGG + Intergenic
1191807935 X:65155382-65155404 TAGTGTTACTTTGAAAAATCTGG - Intergenic
1193360828 X:80576660-80576682 GGGTGCTGCTTGGTAACAACTGG + Intergenic
1193905048 X:87232034-87232056 TAGTGCAGCTAGGATAAAAGTGG - Intergenic
1194056355 X:89138398-89138420 TAGTGCTGTTTGAAAATTACAGG - Intergenic
1195550847 X:106168440-106168462 GAGTGCTGCTTAGGAATAACGGG + Intronic
1198207651 X:134483219-134483241 AAGAACTGCTTGGAACAAACAGG - Intronic
1199803343 X:151272772-151272794 AAATGCTGTTTGGAAAAATCTGG - Intergenic
1200402259 X:156026399-156026421 TAGTGCCCGTTGGAGAAAACAGG - Intergenic