ID: 1145003020

View in Genome Browser
Species Human (GRCh38)
Location 17:19318768-19318790
Sequence GGGGTTCTCACGTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145003020 Original CRISPR GGGGTTCTCACGTGGAAGCC TGG Intronic
900950890 1:5857865-5857887 GGGATGCCCACGTGGAAGCTGGG - Intergenic
901247849 1:7747201-7747223 GGGGTTTTCAACTGGAGGCCTGG + Intronic
901374197 1:8825898-8825920 GAGGTTCCAACGTGGAAGCCAGG + Intergenic
902166898 1:14579785-14579807 GGGGGACTCACATGGCAGCCAGG + Intergenic
903378314 1:22880132-22880154 GGGGTGCCCAGGAGGAAGCCAGG + Intronic
904623565 1:31789576-31789598 GAGGTTCTCTCCTGGAAGCCAGG + Intergenic
905369424 1:37475102-37475124 GGGGCTCTCAGATGGAATCCTGG - Intronic
906405718 1:45540321-45540343 GGGGTTTTACCGTGTAAGCCAGG + Intergenic
909798949 1:79781141-79781163 GGGGTTTTACCGTGGTAGCCAGG + Intergenic
909860176 1:80594655-80594677 GGGTTTCTCAAGTGGCAGGCAGG - Intergenic
914098728 1:144566052-144566074 GGGGTTCTACCGTGTTAGCCAGG - Intergenic
914177276 1:145289273-145289295 GGGGTTCTACCGTGTTAGCCAGG + Intergenic
920446480 1:206022318-206022340 AGGGTGCTCACCAGGAAGCCAGG + Intronic
920788433 1:209064996-209065018 GGGCTTCTCAGCTGGAACCCAGG - Intergenic
1066477862 10:35765197-35765219 GGGGGTCACACGGAGAAGCCTGG - Intergenic
1067003364 10:42638353-42638375 GGGGACCTCACGGAGAAGCCGGG - Intronic
1072975821 10:100056818-100056840 GTGGTTCTCACCTGTAATCCCGG - Intronic
1075710031 10:124525941-124525963 GGGGGTCCCAGGTGGAGGCCGGG + Intronic
1075885607 10:125896608-125896630 GGGGTTCGCCCGCGGAGGCCGGG + Exonic
1076624325 10:131812212-131812234 AGGGTTCTCACGTGGACGCTAGG - Intergenic
1076624345 10:131812293-131812315 AGGGTTCTCACGTGGATGGTAGG - Intergenic
1076624366 10:131812373-131812395 AGGGTTCTCACGTGGACGGTAGG - Intergenic
1078103943 11:8346583-8346605 GGGAGCCTCAGGTGGAAGCCGGG - Intergenic
1080249151 11:30213646-30213668 GGAGGTCTCAGGTGGAACCCGGG - Intergenic
1080687755 11:34529388-34529410 GGGGTTCTCAGGTGGGAGACTGG + Intergenic
1081588477 11:44404104-44404126 GGGGTGCCCACGTGGATGCGGGG + Intergenic
1090647378 11:128776890-128776912 GGGCTGCCCACGTGGAAGGCCGG - Intronic
1096510330 12:52124369-52124391 GGGGTTCTATCGTGTTAGCCAGG + Intergenic
1098137627 12:67419451-67419473 GGGGAACTCTTGTGGAAGCCAGG + Intergenic
1098237191 12:68428554-68428576 GGGGTTTTCATGGGGAAGACAGG - Intergenic
1101891317 12:108718158-108718180 GGGGTTTTAACGTGTTAGCCAGG - Intronic
1103684587 12:122721963-122721985 GGGATTCTCAGATGGCAGCCGGG + Intergenic
1107560176 13:41551188-41551210 GGGCTTCTCACATGGAGGCTCGG + Intergenic
1107886397 13:44877496-44877518 GGGGTTCTACCGTGTTAGCCAGG - Intergenic
1109968985 13:69739803-69739825 GTGGTTCTCATGGGGAAGACAGG + Intronic
1110090364 13:71438035-71438057 GTGGTTCTCACATTGAAACCAGG + Intronic
1111908931 13:94288329-94288351 GGGGTTCCAGAGTGGAAGCCAGG - Intronic
1113576174 13:111396702-111396724 GTGGTTCCCACGTGCAAGACGGG - Intergenic
1113836793 13:113333251-113333273 GGGTTCCTCACGTGTAACCCGGG + Intronic
1120731591 14:88008917-88008939 GGGGTCCTCACTTGGAAACTAGG - Intronic
1122229565 14:100298954-100298976 GGGGTTCTGACAAGGAAGACTGG + Intronic
1125255208 15:37755641-37755663 GAGGTTCTCATGTCAAAGCCTGG + Intergenic
1130012597 15:80163252-80163274 GCGCATCTCACGTGGAAGCCTGG - Intronic
1131437134 15:92432030-92432052 GGAATTCTCCCGTGGATGCCTGG - Intronic
1138443642 16:57049963-57049985 GGGGTTCCACCGGGGAAGCCAGG + Intronic
1138488041 16:57359238-57359260 GGGGTTCTCCCTTGGAAAGCTGG + Intronic
1138692026 16:58777166-58777188 GGTCTTCTCTCGTGGATGCCTGG - Intergenic
1139535517 16:67570271-67570293 CGGGGTCTCACGTGTTAGCCAGG + Intronic
1143839797 17:9723166-9723188 GGGCTTCTCACCTGCAACCCTGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1146818552 17:35965066-35965088 AAGGTCCTCACGTGGAAGTCAGG + Intergenic
1148818192 17:50345847-50345869 GGGGAGCACACGTGGGAGCCAGG + Intergenic
1150182823 17:63143882-63143904 GGGGCTCTCACCTGTAATCCTGG + Intronic
1150390786 17:64788814-64788836 GAGTTTCTCTCCTGGAAGCCAGG - Intergenic
1156975258 18:43213805-43213827 GGGTTTCTCATATGGAAACCTGG - Intergenic
1160022528 18:75191502-75191524 GGGGTCCTCACATGTGAGCCAGG + Intergenic
1160851176 19:1193380-1193402 TGGGGTTTCAGGTGGAAGCCAGG - Intronic
1161543194 19:4864796-4864818 GAGATTCTCAGGGGGAAGCCAGG + Intronic
1163273638 19:16268976-16268998 GGGCAGCTCACGAGGAAGCCAGG - Intergenic
933470981 2:82723037-82723059 GGAGCTCTCAGGAGGAAGCCAGG - Intergenic
934967052 2:98731684-98731706 GGGGTTCTCACCGGGAAGTTGGG - Intergenic
937461705 2:122094478-122094500 GGGGTTTTAACGTGTTAGCCAGG - Intergenic
940959859 2:159773120-159773142 GGGATTCTCATGTGTCAGCCTGG + Intronic
946650964 2:221892268-221892290 GGGGTTCTCACTTAGACGTCAGG - Intergenic
946853248 2:223928429-223928451 GGGGTTCTCACAAGGAGCCCAGG - Intronic
947757415 2:232577367-232577389 TGGGTTCTCAAGTGAAAGCTGGG - Intronic
1170440724 20:16376480-16376502 AGGGTTCTCACGGCTAAGCCAGG - Intronic
1171017679 20:21556694-21556716 CCTGTTCTCAGGTGGAAGCCAGG + Intergenic
1178467733 21:32863905-32863927 GGGGGTCACACTTGTAAGCCGGG + Intergenic
1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG + Exonic
1184132258 22:42523892-42523914 GGGGGTTTCACGTGTTAGCCAGG + Intergenic
1184205558 22:43000224-43000246 GGGGTCCTGACCTGGAACCCGGG - Intronic
1184692117 22:46122169-46122191 GGGGTTCACACCTAGGAGCCAGG - Intergenic
949999945 3:9649281-9649303 GGGTTTCCCCCGGGGAAGCCGGG - Intergenic
953658245 3:44871157-44871179 AGGGTGCTCAGGTGGAAGCCTGG - Intronic
954894359 3:53963376-53963398 GTGGTTCTCAGGTGGCGGCCGGG + Intergenic
956069352 3:65431296-65431318 TGGTTTTTCAAGTGGAAGCCAGG - Intronic
958893842 3:99808690-99808712 GGGATGCTCACTTGGAACCCAGG - Intergenic
968614537 4:1571418-1571440 GTGATTCTCCCGGGGAAGCCTGG - Intergenic
976812288 4:89110761-89110783 GGGCTTCTCAAGTGGAATCGGGG - Intronic
977571843 4:98637038-98637060 GGGCTTCTCATGGGGAAGCTGGG - Intronic
984012579 4:174388345-174388367 GGTGTCCTCACATGGAAACCAGG - Intergenic
992473212 5:77077619-77077641 GAGGTCCCCGCGTGGAAGCCCGG + Exonic
994126583 5:96173933-96173955 GGGGTTTTCCCGTGTTAGCCAGG + Intergenic
995115438 5:108472950-108472972 GGGCTTCTCCCGTGGGAGCATGG + Intergenic
995873841 5:116769864-116769886 GGGGTTTCAACGTGTAAGCCAGG + Intergenic
996025314 5:118638864-118638886 GGGTTTCTCAGGTGGAAGGTGGG - Intergenic
997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG + Intergenic
1001419668 5:171577135-171577157 GGGGCTCCCATGTGGCAGCCTGG - Intergenic
1001694445 5:173659633-173659655 GGAGCTGTCACGTGGGAGCCTGG - Intergenic
1002804195 6:556494-556516 GGGGTTCTGGAGTGCAAGCCGGG - Exonic
1005990776 6:30900384-30900406 GGGGTGCTCTGGTGGAGGCCTGG + Intergenic
1006476738 6:34260383-34260405 GGGGTTTTACCGTGTAAGCCAGG + Intergenic
1006984430 6:38167624-38167646 GCTGTTGTCACGTGGAAACCAGG - Intergenic
1018239732 6:161761612-161761634 GGTTTTCTTACTTGGAAGCCAGG - Intronic
1018758773 6:166872367-166872389 GGGAGTCTCATGTGGAAGCTTGG - Intronic
1023899878 7:44467487-44467509 TGGGTTCTAACTTGGCAGCCTGG - Intronic
1024707884 7:51981121-51981143 GTGGTTCTCACCTGTAATCCCGG + Intergenic
1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG + Intronic
1026947178 7:74324258-74324280 GGGGCTCACACCTGGAATCCCGG - Intronic
1032223654 7:130012889-130012911 ATAGTTCTCACGGGGAAGCCAGG - Intergenic
1032468528 7:132161830-132161852 TGGGTACCCACGTGGGAGCCTGG - Intronic
1035761437 8:2071841-2071863 GGTGTCCTCACGTGGAAGGAAGG + Intronic
1037092152 8:14933643-14933665 GGGGTTCTACCGTGTTAGCCAGG + Intronic
1037848108 8:22302599-22302621 GGGGTGATCACTAGGAAGCCAGG - Intronic
1040601122 8:48884670-48884692 GGGGTTTCCACGTGTTAGCCAGG - Intergenic
1044970025 8:97610333-97610355 AGAGCTCTCACGTGGAAGGCAGG - Intergenic
1045500682 8:102742298-102742320 GGGCTTCTCATGTGAAAGCATGG + Intergenic
1049057169 8:140246529-140246551 AGGGTTCTCATATGGAAGACAGG - Intronic
1049711904 8:144068539-144068561 TGGGGTCTCAGGTGGAGGCCCGG - Intergenic
1052334172 9:27303128-27303150 GGTGGTCTCACGAGGAAGTCAGG - Intergenic
1053479284 9:38404019-38404041 GGGGTTTTCACTTGGATCCCTGG - Intergenic
1054457735 9:65443796-65443818 GGGGTTCTCACCAGGAAGTATGG + Intergenic
1054720550 9:68599382-68599404 GGGGTTTTCCCGTGTAGGCCAGG + Intergenic
1061841081 9:133358960-133358982 GGGTTTCTCAAGTAGAAGGCGGG + Intronic
1062500005 9:136848238-136848260 GGCGTTCCCAGGTGGGAGCCTGG + Exonic
1186308407 X:8290069-8290091 AGGTTTCTCAGGTGGTAGCCAGG - Intergenic
1192214614 X:69150042-69150064 GGGCTCCCCACGTGGGAGCCGGG + Intergenic
1192224966 X:69221721-69221743 GGGCTCCCCACGTGGGAGCCAGG - Intergenic
1192467143 X:71365571-71365593 GGGGGTCTGAGGTGGGAGCCAGG - Intergenic
1192565615 X:72161044-72161066 GGGGTTCTCAGGAGACAGCCAGG - Intergenic
1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG + Intergenic
1194866541 X:99075750-99075772 GGGTCTCTCACTTGGAAGTCTGG - Intergenic
1197049910 X:122045730-122045752 GGGCTTCTCCCATGAAAGCCTGG - Intergenic