ID: 1145007543

View in Genome Browser
Species Human (GRCh38)
Location 17:19346080-19346102
Sequence GGGGACCCACACAGCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145007543_1145007548 8 Left 1145007543 17:19346080-19346102 CCTGGATGGCTGTGTGGGTCCCC 0: 1
1: 0
2: 4
3: 14
4: 220
Right 1145007548 17:19346111-19346133 AGGCTTTCCCAACCCACTGATGG 0: 1
1: 0
2: 3
3: 19
4: 152
1145007543_1145007549 9 Left 1145007543 17:19346080-19346102 CCTGGATGGCTGTGTGGGTCCCC 0: 1
1: 0
2: 4
3: 14
4: 220
Right 1145007549 17:19346112-19346134 GGCTTTCCCAACCCACTGATGGG 0: 1
1: 0
2: 0
3: 17
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145007543 Original CRISPR GGGGACCCACACAGCCATCC AGG (reversed) Intronic
900218453 1:1494735-1494757 AGGGACCCACTCAGCTGTCCAGG + Intronic
900225795 1:1533158-1533180 AGGGACCCACTCAGCTGTCCAGG + Intronic
900564789 1:3326944-3326966 GGGGGCCCTCACAGCCAGGCGGG - Intronic
901049931 1:6420896-6420918 AGGGATCCACAGAGCCAGCCAGG + Intronic
901638385 1:10680826-10680848 GGGGACACACACTGACTTCCCGG + Intronic
902511992 1:16971675-16971697 GCAGCCCCACACATCCATCCTGG - Intronic
902807759 1:18871674-18871696 GGGGTCCCATGCAGGCATCCTGG + Exonic
903738393 1:25544300-25544322 GGGTGCCCAGACACCCATCCAGG + Intronic
904247143 1:29195836-29195858 GGGGACCCAATCACCCCTCCAGG + Intronic
904358622 1:29958337-29958359 TGGGACCCACACAGACACCTTGG + Intergenic
906348775 1:45039017-45039039 GGTGGCCCACCCAGCCCTCCAGG + Exonic
906693202 1:47806558-47806580 GGGCCTCCACACAGCCATCCAGG - Intronic
907682633 1:56578745-56578767 GGGGGCCCCCGCAGCCTTCCTGG - Intronic
908113539 1:60919958-60919980 GGAGACCCACACAGCCAAGGAGG + Intronic
911374338 1:97032686-97032708 GGGTACCCACACAGTCATCCAGG - Intergenic
915113268 1:153578400-153578422 GGGGCCCCACACACCCACCTGGG + Intergenic
916475721 1:165166648-165166670 GGGGATCCAAACAGCCATAAGGG - Intergenic
917926454 1:179793198-179793220 GGGAACACTCACAGCCATGCAGG - Intronic
917971520 1:180211191-180211213 GGGGACAGACACAGGCAACCAGG + Intergenic
920215701 1:204360262-204360284 GGGGCCTCACCCAGCCAGCCTGG + Intronic
920507260 1:206525325-206525347 GGGGACACATCCAGCCTTCCTGG + Intronic
920647361 1:207813514-207813536 GGAGATGCACACATCCATCCTGG + Intergenic
920969228 1:210728645-210728667 GCTTACACACACAGCCATCCAGG + Intronic
922789135 1:228300400-228300422 GGGGCCCCAGACAGCTCTCCTGG - Intronic
1064304056 10:14149528-14149550 GGGGTCCCACTCTGTCATCCAGG + Intronic
1070656064 10:78272353-78272375 GCTGAGCCTCACAGCCATCCAGG + Intergenic
1070814219 10:79312934-79312956 CCAGACCCACACAGCCTTCCTGG - Exonic
1074382234 10:112990678-112990700 AGGGTCCCACTCAGTCATCCAGG - Intronic
1075441635 10:122484468-122484490 GGAGACCCACTCAGCCACCTCGG - Intronic
1076508718 10:130997415-130997437 GGGGACCAACCCAGCCTCCCAGG + Intergenic
1076801701 10:132833957-132833979 TGGGATCCACCCACCCATCCGGG - Intronic
1078934905 11:15941690-15941712 GAGGCCCCACACAGCCAGGCTGG - Intergenic
1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG + Exonic
1084836607 11:71806679-71806701 GGTGACCTCCACAGCCCTCCAGG + Intergenic
1087181287 11:95144841-95144863 GTTCATCCACACAGCCATCCAGG - Intergenic
1087256650 11:95963531-95963553 GAAGAACCACACAGCCATCATGG + Intergenic
1089649823 11:119905513-119905535 GGTGACCCACACAGCCTCCTTGG - Intergenic
1090284453 11:125487359-125487381 GAGGACCTACACAGTCAACCAGG + Intronic
1091608600 12:1981763-1981785 GGGGACTCACAAAAACATCCAGG + Intronic
1092046257 12:5433311-5433333 GGGCACCCGCGCAGCCAGCCAGG + Intronic
1092402627 12:8189426-8189448 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1093717496 12:22400438-22400460 TGGGACCCTCCCAGCCAGCCAGG - Intronic
1097438864 12:59585126-59585148 GGGATCCCATACAGCCATCAAGG - Intergenic
1102812277 12:115834555-115834577 GGCGATCCACCTAGCCATCCTGG - Intergenic
1103543913 12:121686140-121686162 GGGGTCTCACTCTGCCATCCAGG - Intergenic
1103789373 12:123458535-123458557 CGGAACCCACAGAGCCCTCCAGG - Intronic
1105881919 13:24613213-24613235 GGGGTCCCACACTGCCTTGCCGG - Intergenic
1111576953 13:90167153-90167175 GGGGAACCTTACAGCCATCTTGG - Intergenic
1111605817 13:90538088-90538110 GGAGACCCACGCTGCCATCTGGG - Intergenic
1111637027 13:90919004-90919026 GGGGTAGCACACAGCCAGCCAGG + Intergenic
1113639055 13:111944286-111944308 GAGGACCCACACCCCCATGCAGG + Intergenic
1118840714 14:69508445-69508467 AGGGTCCCACACTGTCATCCAGG + Intronic
1119853101 14:77880110-77880132 GAGTGCGCACACAGCCATCCTGG + Intronic
1121320931 14:92991260-92991282 AGGGACCCACCCAGCGATGCTGG + Intronic
1121872888 14:97425790-97425812 GGGGATCCACCCAGACATCTTGG + Intergenic
1125765681 15:42134026-42134048 GGGGACTCACACAGCCTTGAAGG - Intergenic
1126441374 15:48693143-48693165 GGGGACTCACTCTGTCATCCAGG - Intergenic
1130340266 15:82995232-82995254 TGGGACCCATGCAGCCAGCCTGG - Intronic
1131517163 15:93087305-93087327 GGGCACCCACACATCCAGGCGGG - Intronic
1132095562 15:98981936-98981958 GGGGACCCACAGTAACATCCGGG + Intronic
1132739524 16:1404525-1404547 GGGGACCCTGAGAGCCAGCCAGG - Intronic
1133989483 16:10693528-10693550 ACGGACCCACACAGACATACAGG + Intronic
1136155889 16:28381857-28381879 GGAGAGGCACACAGCCCTCCTGG + Intronic
1136186054 16:28589603-28589625 GTGTCCCCACACAGCCATGCTGG + Intronic
1136207196 16:28733432-28733454 GGAGAGGCACACAGCCCTCCTGG - Intronic
1136551462 16:30984557-30984579 AGGGACCCACCCCGCCATCCTGG - Exonic
1138549520 16:57739953-57739975 GGGGACAGACAGAGCCCTCCAGG + Intronic
1139493424 16:67299508-67299530 GGGGGCCCGCACAGCCAGCCTGG - Exonic
1141394172 16:83690396-83690418 GGTGAGCCACACAGCTATCCCGG + Intronic
1141529658 16:84637454-84637476 GGGTACTCACACATCCATCCTGG - Intergenic
1141620928 16:85236088-85236110 CGGGAGCCACACAGGCAGCCAGG - Intergenic
1141950889 16:87338678-87338700 GGTGACCCACACAGAGATGCAGG + Intronic
1142397848 16:89842820-89842842 GGGGACCCACACCCCCACCGTGG + Intronic
1142520372 17:500408-500430 GGGTACCCACACACCCACCATGG + Intergenic
1142599871 17:1048367-1048389 GGAGACCCACACAGCTCCCCAGG + Intronic
1142611133 17:1109629-1109651 GGCGACCCCCAGAGCCACCCCGG + Intronic
1142863579 17:2777495-2777517 CGGCACCCCCACACCCATCCAGG - Intronic
1143380023 17:6490235-6490257 GGGGACACACACAGACTTACAGG + Intronic
1144499285 17:15771184-15771206 GGTGGCCCACCCAGCCTTCCAGG + Intergenic
1145007543 17:19346080-19346102 GGGGACCCACACAGCCATCCAGG - Intronic
1145162676 17:20586217-20586239 GGTGGCCCACCCAGCCTTCCAGG + Intergenic
1148619314 17:49022516-49022538 AGGGACTCACCCAGCCCTCCAGG - Intronic
1148746876 17:49923500-49923522 GGGGACCCCCACCCCCATCAAGG + Intergenic
1150335259 17:64326299-64326321 TGGGACCTCCACAGCCAGCCTGG + Intronic
1151408404 17:73904161-73904183 GGGGACCCACTCAGGAATCATGG + Intergenic
1151437167 17:74104943-74104965 GGGGACAGCCACAGTCATCCTGG - Intergenic
1151579229 17:74968714-74968736 GGAAACCCACAGAGCCATCTGGG + Intronic
1151651990 17:75475805-75475827 GGAGACCCTCACAGCCATGCAGG - Intronic
1151672265 17:75577696-75577718 TGGGATCCCCACAGCCATCCAGG + Intergenic
1151890283 17:76947440-76947462 GGAGAGCCTCACAGCCAGCCTGG + Intronic
1152534081 17:80940606-80940628 GGGCACCCGCACAGCCAGCCAGG + Intronic
1152573304 17:81129794-81129816 AGGGACCCCCACAGCCATCCGGG + Intronic
1152627157 17:81393146-81393168 GGGGACCCGCGGAGCCCTCCGGG - Intergenic
1153101413 18:1474328-1474350 GGAGACTCACAGAGCCATCTGGG + Intergenic
1153323220 18:3793330-3793352 GGAAAGCCACACAGCCCTCCGGG - Intronic
1156682978 18:39613491-39613513 GAGGACACACACACCCACCCGGG - Intergenic
1158452694 18:57581021-57581043 GGGGAGCCTCACAGACAGCCTGG - Intronic
1158537288 18:58319603-58319625 GAGCACCCTCAAAGCCATCCTGG + Intronic
1159076242 18:63684942-63684964 TGGGCCCCACTCAGCCATGCTGG + Intronic
1161013579 19:1971667-1971689 CAGGACCCACATAGCCATCTGGG - Intronic
1161038736 19:2099003-2099025 TGGGACACACAGAGCCACCCCGG + Exonic
1161063147 19:2225241-2225263 GGGGACCCGTGCAGCCACCCTGG - Intronic
1161250561 19:3277766-3277788 GGTCACCCACACAGCCAGCCAGG - Intronic
1161778794 19:6278435-6278457 GGGAACCCACCCACCCACCCTGG + Intronic
1161887189 19:7005944-7005966 GGTGACCTCCACAGCCATCTTGG + Intergenic
1161888013 19:7011958-7011980 GGTGACCTCCACAGCCATCTTGG - Intergenic
1162110966 19:8399572-8399594 GGGGACCCAGGCAGCCAGGCAGG - Intronic
1162464654 19:10832529-10832551 GGGGCCCCACACAGGCATGAGGG - Exonic
1162918611 19:13887429-13887451 GGGGATCCAGACAGACAGCCAGG - Intronic
1164443132 19:28294576-28294598 GAGGACACACACACCCAACCTGG + Intergenic
1164933685 19:32194997-32195019 GGGGACCCTCTCACCCCTCCTGG + Intergenic
1165674977 19:37714536-37714558 GGGGTCTCACTCTGCCATCCAGG - Intronic
1166887571 19:45971522-45971544 GGACACCCTCACAGGCATCCAGG + Intronic
925024157 2:594800-594822 GGAGATCCACACCGCCATCCAGG + Intergenic
925550252 2:5066152-5066174 GGGGACCCACAGAGAAACCCAGG + Intergenic
925585652 2:5461514-5461536 GGGGATCCACAAAGCCACCTGGG + Intergenic
926821218 2:16853819-16853841 GGTCAGCAACACAGCCATCCAGG - Intergenic
927023124 2:19038387-19038409 GGGGCTTCACTCAGCCATCCTGG + Intergenic
927037062 2:19188929-19188951 GGGGGCCCACAGAGTCAACCCGG + Intergenic
930102572 2:47614715-47614737 GGGGAGCCACCCAGCCCCCCAGG + Intergenic
931503578 2:62898802-62898824 GGAGACCAAGACAGTCATCCTGG + Intronic
933681586 2:85106449-85106471 GGGGACTCACTCTGCCACCCAGG - Intergenic
933970808 2:87468581-87468603 GGAGACCCAGCCAGCCCTCCTGG - Intergenic
936322922 2:111481615-111481637 GGAGACCCAGCCAGCCCTCCTGG + Intergenic
936500109 2:113060016-113060038 GGAGTCCCACAGAGGCATCCAGG + Intronic
937424625 2:121788438-121788460 GGGGTCTCACACAGTCACCCAGG + Intergenic
938062969 2:128266753-128266775 GAGGGCCCACACAGGCACCCTGG - Exonic
938224759 2:129606229-129606251 GGCGAGGAACACAGCCATCCAGG + Intergenic
947220987 2:227792177-227792199 GGGGTCTCACTCAGCCACCCAGG + Intergenic
947478048 2:230469349-230469371 GGGTGCCCACACAGTCATTCAGG + Intronic
948639482 2:239365881-239365903 GGGGACACACAGAGACATGCAGG + Intronic
948907484 2:240986744-240986766 AGGTGCCCACACAGCCACCCAGG + Intronic
1172961856 20:38805734-38805756 GGGGACCCACAGACACAGCCGGG + Exonic
1173192480 20:40887122-40887144 GGGGACCCCTCCAGGCATCCTGG - Intergenic
1174581667 20:51576590-51576612 TCTGACCCACACAGCCAACCTGG - Intergenic
1174681741 20:52415280-52415302 GGGGAGCCAAGAAGCCATCCAGG - Intergenic
1175373835 20:58511142-58511164 CTGGACCCACACAGCCTCCCTGG - Intronic
1176231299 20:64034381-64034403 GGGGACCCACACCCACATTCTGG - Intronic
1179009568 21:37545909-37545931 GTGGACCTACATCGCCATCCTGG - Intergenic
1179475433 21:41640203-41640225 GGGGAGCCATACAGCCATGGAGG + Intergenic
1179950810 21:44707937-44707959 GGGGTCACACACATCCCTCCTGG + Intronic
1179982013 21:44900570-44900592 GGGGACCCACACCAGCCTCCGGG - Intronic
1179986709 21:44926225-44926247 GGGGACCCAGACCTCCATTCCGG + Intronic
1180142462 21:45900661-45900683 GGGGACCCACCCCGCCCACCCGG - Intronic
1180889414 22:19275309-19275331 AGGGGGCCACACAGCCTTCCTGG + Intronic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1181403674 22:22667119-22667141 GGAGGCTCAGACAGCCATCCTGG - Intergenic
1181980826 22:26765027-26765049 TGAGACCCCCACAGCCTTCCTGG - Intergenic
1182066190 22:27433482-27433504 GAGGACCCACACAGCCATGCAGG + Intergenic
1182712006 22:32329015-32329037 GGGAACCCCCAGAGCCATGCTGG - Intergenic
1182854132 22:33502168-33502190 GGGGTCTCACTCTGCCATCCAGG - Intronic
1184208869 22:43023553-43023575 GGGAACCCACACTCCAATCCAGG + Intergenic
950138841 3:10601457-10601479 GGAGACTCTCACAGCCAGCCTGG - Intronic
950585209 3:13887396-13887418 GGTGAACCATACAGCCATCTGGG - Intergenic
952693961 3:36244060-36244082 GGGGACCCAGAGAGCTATTCCGG + Intergenic
953030352 3:39175868-39175890 GGGGGCCTACACTGCCCTCCTGG + Intergenic
953387733 3:42516198-42516220 GTGGGCACACACAGCCAGCCTGG + Intronic
954066607 3:48111715-48111737 GGGGGACCACACGGCCACCCAGG - Intergenic
954211121 3:49097996-49098018 GTGGATCCAGACAGCCATCAGGG - Exonic
954304181 3:49716892-49716914 GGGGGCCCCCATGGCCATCCTGG - Exonic
955386250 3:58483380-58483402 GGGGTCCCACCCAGTCATCTTGG + Intergenic
957798908 3:85049374-85049396 GGAGTCTCACACAGTCATCCAGG + Intronic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
966681319 3:182644661-182644683 GGGGATCCACAAAGCCTTCCTGG - Intergenic
967863906 3:194174924-194174946 AGGGACTCACTCTGCCATCCAGG + Intergenic
969488435 4:7485432-7485454 TGGGGCCCACAGAGCCAACCTGG - Intronic
969778016 4:9374200-9374222 GGTGACCTCCACAGCCCTCCAGG + Intergenic
970539607 4:17064301-17064323 GGGGACCCACAGACACAACCAGG + Intergenic
971537400 4:27771101-27771123 CGTGACTCTCACAGCCATCCAGG + Intergenic
977916957 4:102604838-102604860 GGGGACTTACACAGACATTCTGG - Intronic
977938754 4:102835015-102835037 GGATACCCACAGAGCCATCAGGG - Intronic
985441045 4:189982702-189982724 TGGGAACAACACAGCCGTCCAGG - Intergenic
985819542 5:2150230-2150252 GAGGACCCACACAGCCCTCCAGG - Intergenic
986037212 5:3951740-3951762 GGGGACCCAAAATGTCATCCTGG - Intergenic
992671852 5:79069506-79069528 GGGGCCCCACTCACCCTTCCCGG + Exonic
996816213 5:127575314-127575336 GGGGAAACATACAGACATCCAGG + Intergenic
1000064398 5:157682600-157682622 AGGGACACACACAGCCTTCCAGG - Intergenic
1001982560 5:176046901-176046923 TGGGACCTACACAGCCACCTGGG - Intergenic
1002234901 5:177797156-177797178 TGGGACCTACACAGCCACCTGGG + Intergenic
1003894215 6:10591517-10591539 TGGCTCCCACACAGCCAACCTGG + Intronic
1004091230 6:12503827-12503849 GGTGAGCCACACACCCACCCGGG + Intergenic
1005276055 6:24219612-24219634 GTATACCCACACAGCCAACCCGG - Intronic
1006506097 6:34489748-34489770 GGGGACCCAAAGAGGCATCGTGG - Intronic
1007528896 6:42522624-42522646 GGGGTCTCACTCTGCCATCCAGG - Intergenic
1007836735 6:44679729-44679751 GGGGTGCCACACAGACATACGGG - Intergenic
1010807710 6:80258579-80258601 GGGGAGCCTCAGAGCCATCTGGG - Intronic
1013010856 6:106118553-106118575 GGGCACCTTCAAAGCCATCCTGG + Intergenic
1014078937 6:117266715-117266737 GGGGACCCCTACAGCCTCCCAGG - Intronic
1016124960 6:140388548-140388570 GGGCATGCACACAGACATCCTGG - Intergenic
1016532034 6:145069528-145069550 GGGGACCAACACAGTCACCCAGG - Intergenic
1016895296 6:149045530-149045552 GGGTACCCACACACACTTCCTGG - Intronic
1017065769 6:150527784-150527806 GGAGACCCACAGAGCTTTCCAGG - Intergenic
1019168452 6:170115046-170115068 GGCGACCCACACATACATTCAGG - Intergenic
1022894946 7:34740549-34740571 GGGGACCCACAGAGCCCACAGGG + Intronic
1024917900 7:54524631-54524653 GGAGACCCTCACCCCCATCCTGG - Intergenic
1025729119 7:64094419-64094441 GTGGAACCACATAGCCTTCCTGG + Intronic
1027138399 7:75639896-75639918 GGGGACGCTCAGAGCCTTCCTGG - Intronic
1032394135 7:131576801-131576823 AGGGACCCACCCACCCAGCCTGG - Intergenic
1032404850 7:131648618-131648640 TGGGTCCCACACAGACAGCCAGG - Intergenic
1032877596 7:136054163-136054185 GGGGACCCACACAGACAGAGAGG + Intergenic
1034439192 7:151077848-151077870 AGGGGCCCAGCCAGCCATCCTGG + Intronic
1036275471 8:7348170-7348192 GGTGACCTCCACAGCCCTCCAGG + Intergenic
1036345883 8:7962188-7962210 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1036841211 8:12122941-12122963 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1036863017 8:12369193-12369215 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1037700981 8:21273575-21273597 GGGGACCTCCACCCCCATCCAGG + Intergenic
1046181303 8:110652359-110652381 GGGTACCCAAAAAGCTATCCAGG - Intergenic
1047356781 8:124129584-124129606 GGCCACCCACTCTGCCATCCGGG - Intergenic
1048878733 8:138856772-138856794 AGGGACCCACTGGGCCATCCTGG - Intronic
1056539257 9:87557212-87557234 TGGCAGCCACACATCCATCCAGG + Intronic
1058486441 9:105447502-105447524 GGGGACCCACCCATCCTCCCCGG - Intergenic
1059289110 9:113206508-113206530 GGGGAACCACACAGCCAGAGAGG - Exonic
1061367761 9:130181494-130181516 GGGGACCCCCACAGGGCTCCTGG - Intronic
1061379511 9:130245630-130245652 GGGGCCCCCCACAACCACCCAGG + Intergenic
1062210040 9:135358627-135358649 GCGGACCCAGACAACCCTCCCGG - Intergenic
1062286076 9:135773106-135773128 GGGGCCCAACACAGACATCAGGG + Intronic
1062286686 9:135776281-135776303 GGGGTCCCACTCTGTCATCCAGG + Intronic
1062423238 9:136494063-136494085 AAGGTCCCACCCAGCCATCCTGG - Intergenic
1062454952 9:136631671-136631693 GAGGAGGCACACAGCCACCCGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185831869 X:3310480-3310502 GGGGACCCCGACACCCAGCCTGG - Exonic
1186885595 X:13910123-13910145 GGGGAGCCACACCACCCTCCAGG - Intronic
1190767640 X:53488686-53488708 GGGGACCCACAATGCCATTGTGG - Intergenic
1194165282 X:90507668-90507690 GGGGACCCACAGAGCCCACAGGG - Intergenic
1197661608 X:129179464-129179486 GGGGAGGCACACAACCAGCCAGG - Intergenic
1197703101 X:129614831-129614853 GGGCACCCACTCATCCCTCCTGG + Intergenic
1200128310 X:153828582-153828604 GGGGCTCCCCACAGCCCTCCGGG - Intronic
1200511551 Y:4085478-4085500 GGGGACCCACAGAGCCCACAGGG - Intergenic
1200989322 Y:9334838-9334860 GTGGAGGAACACAGCCATCCCGG - Intergenic
1201244135 Y:11986600-11986622 GGGGACCCTGACACCCAGCCTGG + Intergenic
1202115238 Y:21465521-21465543 GTGGAGGAACACAGCCATCCAGG - Intergenic