ID: 1145010968

View in Genome Browser
Species Human (GRCh38)
Location 17:19367744-19367766
Sequence CAGAGGAAGGGGCATTTATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145010968_1145010984 25 Left 1145010968 17:19367744-19367766 CCCGATAAATGCCCCTTCCTCTG 0: 1
1: 0
2: 4
3: 17
4: 210
Right 1145010984 17:19367792-19367814 TTGGTCTAGGGGCTCTCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 108
1145010968_1145010976 6 Left 1145010968 17:19367744-19367766 CCCGATAAATGCCCCTTCCTCTG 0: 1
1: 0
2: 4
3: 17
4: 210
Right 1145010976 17:19367773-19367795 CTTTTTTCTGATCCCCAACTTGG 0: 1
1: 0
2: 0
3: 17
4: 208
1145010968_1145010978 13 Left 1145010968 17:19367744-19367766 CCCGATAAATGCCCCTTCCTCTG 0: 1
1: 0
2: 4
3: 17
4: 210
Right 1145010978 17:19367780-19367802 CTGATCCCCAACTTGGTCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 79
1145010968_1145010983 24 Left 1145010968 17:19367744-19367766 CCCGATAAATGCCCCTTCCTCTG 0: 1
1: 0
2: 4
3: 17
4: 210
Right 1145010983 17:19367791-19367813 CTTGGTCTAGGGGCTCTCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 165
1145010968_1145010979 14 Left 1145010968 17:19367744-19367766 CCCGATAAATGCCCCTTCCTCTG 0: 1
1: 0
2: 4
3: 17
4: 210
Right 1145010979 17:19367781-19367803 TGATCCCCAACTTGGTCTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1145010968_1145010977 12 Left 1145010968 17:19367744-19367766 CCCGATAAATGCCCCTTCCTCTG 0: 1
1: 0
2: 4
3: 17
4: 210
Right 1145010977 17:19367779-19367801 TCTGATCCCCAACTTGGTCTAGG 0: 1
1: 0
2: 2
3: 15
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145010968 Original CRISPR CAGAGGAAGGGGCATTTATC GGG (reversed) Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
903023272 1:20409498-20409520 CAGAGGATGGGGAGTTTTTCTGG + Intergenic
904025338 1:27499308-27499330 CAGAGGAAGGGCCATTTGGAAGG + Intergenic
904885111 1:33731602-33731624 CAGAAGTCGGGTCATTTATCTGG - Intronic
907037659 1:51230375-51230397 CAGAGGGAGGGACAATGATCCGG + Intergenic
910460814 1:87446228-87446250 CAGAGGAAGGTGAGATTATCTGG + Intergenic
915332443 1:155121544-155121566 CAGAGGAAGGAATGTTTATCTGG - Intergenic
917759516 1:178141320-178141342 CAGAGGAAGGGGCAATGATTGGG - Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918475378 1:184918588-184918610 CAGATGAATAGGAATTTATCTGG - Intronic
919741500 1:200983888-200983910 CCCAGGAAGGGGCATTTCTGTGG + Intronic
920176404 1:204104559-204104581 CAGAGGAAGTGGCATTCCCCTGG + Intronic
920836372 1:209514464-209514486 CACAGAGAGGGGCATTCATCAGG - Intergenic
1062786571 10:270027-270049 TTGAGGAAGGGGCATTTCTGGGG + Intergenic
1063294653 10:4792546-4792568 CAGAGCAAGGAGGATTTAGCAGG - Intronic
1063945529 10:11172534-11172556 CAGAGTATGGGGCATTTAAAGGG - Intronic
1064898919 10:20272103-20272125 CAGGGGAAGGGCCCTTTTTCAGG + Intronic
1066210221 10:33229722-33229744 CAGAGGAAGGAGCAATTGACTGG + Intronic
1069191671 10:65498795-65498817 CTGAGGAAGTGGCATTTAAGCGG + Intergenic
1071056308 10:81512835-81512857 CAGATGATGGGGTATTTATAAGG - Intergenic
1071228654 10:83561327-83561349 CAGAGTAAGGTCCATTTATGGGG + Intergenic
1073151997 10:101318339-101318361 CACAGGAAGGGGAATTTAGGGGG - Intergenic
1075734319 10:124654685-124654707 CAGAGGAAGGGACATCTCTGCGG + Intronic
1076276129 10:129200234-129200256 CATATGAAGGGGAGTTTATCAGG + Intergenic
1077233121 11:1467499-1467521 CTGAGGAAGGGGAGGTTATCTGG - Intergenic
1078426027 11:11252103-11252125 CTGAGGCAGGGGAATTGATCAGG + Intergenic
1081989642 11:47330861-47330883 CAGCGGAAAGTGCATTTAACTGG - Intergenic
1083052372 11:59788775-59788797 CAGAGGAGGGGAGCTTTATCGGG - Intronic
1083949800 11:65947639-65947661 CAGAGAAAGGGGCAGATTTCTGG + Exonic
1084968298 11:72755806-72755828 CAGAGGGTGGGGCTTTTGTCAGG - Intronic
1088142483 11:106634034-106634056 AACAGAAATGGGCATTTATCAGG + Intergenic
1089090791 11:115873124-115873146 CAGAGCAGGGGCCATTTAACGGG + Intergenic
1089110652 11:116053281-116053303 CAGAGGATGGGCTAATTATCAGG - Intergenic
1090026000 11:123168241-123168263 CAGAGGGAAGGCCATGTATCTGG + Intronic
1090471804 11:126987602-126987624 CAGAGAAAGGAGCATTGATATGG + Intronic
1091368296 11:135039550-135039572 CTCAGGAAGGGGAATTTAGCAGG + Intergenic
1094032392 12:26027489-26027511 CAGATGAATGGGTATTTATCTGG + Intronic
1094457191 12:30649136-30649158 CAAAGGAAGGGGAATTGATCAGG - Exonic
1097350377 12:58542486-58542508 CAGATGAAGGTGCATTTGTGTGG + Intergenic
1098087563 12:66863520-66863542 GAGAGAAAGGTGCATTTATATGG + Intergenic
1099102455 12:78459481-78459503 CAGCGGGAGGGACAATTATCAGG + Intergenic
1100359217 12:93860924-93860946 GAGAGGAGGGGGCTTTTATAAGG - Intronic
1101808490 12:108086917-108086939 CAGAGGACAGGGCATTTATCTGG - Intergenic
1102998302 12:117366223-117366245 CAGACCAAGGGGCATTTCTTGGG - Intronic
1103611826 12:122128787-122128809 GTGGGGAAGGGGCATTTATGGGG + Intronic
1104391827 12:128397383-128397405 CAAAGGAAGGTGCATCTTTCTGG + Intronic
1104771885 12:131368897-131368919 CAGAGGAAGGGGCATGGAGGAGG + Intergenic
1106647074 13:31647752-31647774 AAGGGGACGGGGCATTTATATGG - Intergenic
1107740261 13:43443037-43443059 CAGAGGATGTGGCTTTTATAGGG - Intronic
1107932317 13:45316369-45316391 CAAAGGAAGCAGCATTTATCTGG + Intergenic
1108947999 13:56046512-56046534 CAGGGGGAGGGGCAATGATCGGG - Intergenic
1110830582 13:80026039-80026061 CAGAGGAAGGGGCATGCATCAGG - Intergenic
1111047909 13:82839535-82839557 AAGAAGAAGGTGCATTTTTCTGG + Intergenic
1111958003 13:94779329-94779351 TATACGAAGGGGCATTTATTAGG - Intergenic
1112712825 13:102150086-102150108 CAGTGGAAAGAGCATTGATCAGG + Intronic
1113921214 13:113913637-113913659 CAGTGGAGGAGGCATTGATCAGG + Intergenic
1113921219 13:113913681-113913703 CAGTGGAGGAGGCATTGATCAGG + Intergenic
1113921224 13:113913725-113913747 CAGTGGAGGAGGCATTGATCAGG + Intergenic
1113921230 13:113913769-113913791 CAGTGGAGGAGGCATTGATCGGG + Intergenic
1113921236 13:113913814-113913836 CAGTGGAGGAGGCATTGATCGGG + Intergenic
1113921242 13:113913859-113913881 CAGTGGAGGAGGCATTGATCGGG + Intergenic
1113921248 13:113913904-113913926 CAGTGGAGGAGGCATTGATCGGG + Intergenic
1113921283 13:113914172-113914194 CAGTGGAGGAGGCATTGATCAGG + Intergenic
1113921301 13:113914350-113914372 CAGTGGAGGAGGCATTGATCAGG + Intergenic
1114616306 14:24070270-24070292 CAGAGGAAGGGGCTTTTGAGTGG - Intergenic
1118674031 14:68163371-68163393 CAGAGGAATGTTCATTGATCTGG - Intronic
1118738118 14:68716986-68717008 CAGAGTACCCGGCATTTATCAGG - Intronic
1119295300 14:73528005-73528027 CAGGCTAAAGGGCATTTATCTGG - Intronic
1120097354 14:80403686-80403708 CAGAGGGAGGGACAATGATCAGG + Intergenic
1120108011 14:80518149-80518171 CAGAGGGAGGGACAATGATCAGG - Intronic
1120227563 14:81808373-81808395 AAGAGAGAGGGGCCTTTATCAGG - Intergenic
1120456128 14:84732398-84732420 CAGATGAGAGGGCATTTATTAGG - Intergenic
1120541922 14:85761461-85761483 CGGAGGAATGGCCATTTGTCGGG + Intergenic
1120913302 14:89687631-89687653 CAGAGGAAGTTGCATTGAGCTGG + Intergenic
1122956528 14:105074001-105074023 TAGAGGAAGGGGAGTTTATTAGG - Intergenic
1124645329 15:31434348-31434370 CAGAGGAGGTGGCATTGAGCTGG + Intronic
1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG + Intergenic
1125509999 15:40287751-40287773 CAGAGGCAGGGCCATTTCACTGG + Intronic
1126687433 15:51260793-51260815 CAGAGGGAGGGACAATGATCAGG + Intronic
1127676155 15:61241405-61241427 CAGAGGAAAGGGCACTAATGGGG - Intergenic
1128879557 15:71230863-71230885 CAGAGGAAGAGGCATCTTTTTGG - Intronic
1130683519 15:86017029-86017051 CAGTGCAAGGGGCATGCATCTGG + Intergenic
1131550299 15:93351306-93351328 CAGAGGCAGGAGCCTCTATCTGG + Intergenic
1133429575 16:5724945-5724967 CTGGGGAAGGGCCATGTATCAGG + Intergenic
1133854023 16:9532691-9532713 CAAAGGAAGGAACATTTTTCAGG + Intergenic
1136230184 16:28881109-28881131 CAGAGGAAGAGGCAAGTATGGGG - Intronic
1140481126 16:75263466-75263488 CAGAGGAAGGGGCACTGAGCAGG + Intronic
1141472866 16:84251547-84251569 TGGAGGAAGGGGCATTGAGCTGG + Intergenic
1141953471 16:87354051-87354073 CAGAGGAATGGACATTTGTAAGG + Intronic
1142994048 17:3750635-3750657 CAGAGGAAGTGGCATTTGGATGG + Intronic
1144027068 17:11286689-11286711 CAGAGGAAGGTTCTTTTATTGGG + Intronic
1144421092 17:15099278-15099300 CAGAGAGATGGACATTTATCAGG - Intergenic
1144457300 17:15429715-15429737 CAGAGCAGGGGGCTTTTGTCTGG - Intergenic
1145010968 17:19367744-19367766 CAGAGGAAGGGGCATTTATCGGG - Intronic
1147660818 17:42115979-42116001 CAGAGGAAGGGGAGCTTATGGGG + Intronic
1148948417 17:51286640-51286662 GAAAGGAAGGGGCCTTCATCAGG - Intronic
1149080072 17:52644948-52644970 AAGAGGAGGGGGCATTTTCCTGG + Intergenic
1149383652 17:56120566-56120588 CAGAGGAGGCGGCAGTAATCAGG - Intronic
1149649289 17:58266819-58266841 CAGAGAAAAGAGCATATATCTGG + Intronic
1150140919 17:62727866-62727888 CAGGGGATGGGGCAATTATGAGG + Intronic
1151157206 17:72133592-72133614 AAGAGAAAGGGGTATTTATATGG + Intergenic
1156920270 18:42513887-42513909 TAGAGGAAGGGGAATTGAGCAGG - Intergenic
1162297249 19:9821780-9821802 CAGAGGAAGGAGCTTGTATGTGG - Intronic
1162589836 19:11584232-11584254 CAGGGAAGGGGGCTTTTATCTGG + Intronic
1163023725 19:14497204-14497226 ATAAGGAAGGGGGATTTATCAGG + Intergenic
1163327754 19:16616066-16616088 GAGAGGAAGGGGCAGCTCTCAGG + Intronic
1165746367 19:38232207-38232229 CTGAGGAGGTGGCATTTAACCGG - Intergenic
1166229988 19:41421099-41421121 CAGAGGAGGGGGCATTTAGGGGG + Intronic
1168147040 19:54425419-54425441 CAGGGGAAGGGACAATGATCTGG - Intronic
927730332 2:25465402-25465424 CAAAGGAAGGGGTATGTATATGG + Intronic
929325317 2:40603547-40603569 AGGAGGAATGGGCTTTTATCTGG - Intronic
930631800 2:53761306-53761328 CAGAGGGAGGGACAATGATCAGG + Intronic
930715230 2:54587818-54587840 CAGCGGAGTGGGTATTTATCTGG - Intronic
931502794 2:62888785-62888807 AAAAGGAAGGGGATTTTATCTGG + Intronic
931909469 2:66881627-66881649 TAGAAGAGGGGACATTTATCAGG + Intergenic
931971027 2:67586530-67586552 AAGAGGAAGGTGCAGATATCAGG + Intergenic
935645586 2:105330816-105330838 CTGGGGATGGGGCATTTATGTGG - Intergenic
937104284 2:119295370-119295392 AGGAGGAAGGGGCACTGATCAGG + Intergenic
937665835 2:124485633-124485655 AAGAAGAAGGTGCATTTACCGGG + Intronic
939985326 2:148824554-148824576 TAGATGAAGAGGCATTTATTAGG - Intergenic
940042197 2:149372272-149372294 GAGAGGAACGGGACTTTATCAGG - Intronic
941211544 2:162646293-162646315 TAGAGGAAGATGAATTTATCTGG + Intronic
944135717 2:196397304-196397326 CAGAAGAAGAGACATTTCTCTGG - Intronic
945148300 2:206761964-206761986 CAGGATAAGGGGCTTTTATCAGG - Intronic
946162074 2:217841413-217841435 CAGGGGACGGGGCATTAAACAGG + Intronic
948289140 2:236811718-236811740 TGGAGGAAGGGGCACTTGTCAGG - Intergenic
948584589 2:239011506-239011528 CAGAGGAAGGGGCCTATCTCCGG + Intergenic
1168932800 20:1637566-1637588 CAAAGGAAATAGCATTTATCTGG - Intronic
1173070561 20:39760653-39760675 CAGATCTAGGGGCCTTTATCTGG + Intergenic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1175034824 20:55989999-55990021 CAGAGGAAGGGGCATACAGTAGG + Intergenic
1175689110 20:61052952-61052974 CAGAGGAAGGGGAATTGGCCCGG + Intergenic
1177359389 21:20048827-20048849 CAGAGGGAGGGACAATGATCGGG - Intergenic
1177389128 21:20443643-20443665 TATATGAAGGGGCGTTTATCAGG - Intergenic
1177838099 21:26208044-26208066 CAGAGGAAGAAGCATTTAACTGG + Intergenic
1183590404 22:38776372-38776394 CAGAGGAGGTGGCATTGAACTGG - Intronic
1184246137 22:43236689-43236711 GAGGGGAAGAGGCATTTATCAGG - Intronic
1185223094 22:49639002-49639024 CAGATGAAGCGGGCTTTATCCGG - Intronic
949785324 3:7733885-7733907 CAGTGGAAGGGGCATTGATTTGG - Intronic
950718619 3:14866889-14866911 CAGAGGCAGGAGCATCCATCCGG + Intronic
951538471 3:23760960-23760982 CAGAGGGAGGGCCATTAAACAGG - Intergenic
951757600 3:26108564-26108586 CAGCGGAAGGGACAATGATCGGG + Intergenic
951986340 3:28625921-28625943 ATGAGGAAGGGACCTTTATCTGG + Intergenic
956394251 3:68808237-68808259 CAGTGGAAGGGTCATTTTTAGGG - Intronic
956942855 3:74184153-74184175 TAGAGGAAGGGGCTCTTTTCTGG - Intergenic
957103987 3:75862787-75862809 CAGACGAAGGGACATTTCCCTGG - Intergenic
958168307 3:89905896-89905918 CACAGGTAGGGTCATTTATAAGG + Intergenic
958702915 3:97616111-97616133 CAGAGGAAGGGCCATCTTTGCGG + Intronic
959228303 3:103615084-103615106 CAGAGGGGGGTGCATTTGTCAGG - Intergenic
959406319 3:105965990-105966012 CAGAGGGAGGGACAATTATCCGG + Intergenic
960531510 3:118770980-118771002 ATGATGAAGGGGCATTTATTAGG + Intergenic
961176314 3:124837976-124837998 CAGTGGAAGGGCCTTTAATCTGG + Intronic
961393247 3:126569128-126569150 CAGAGGAAGGGGCCTTGACAGGG + Intergenic
961584501 3:127910952-127910974 CAGGGGAAGGGGCATCCTTCTGG + Intergenic
963702392 3:148642540-148642562 GCAAGGAATGGGCATTTATCTGG + Intergenic
965206333 3:165722128-165722150 CAGAGGAAGGAACATTTAAAAGG + Intergenic
965371273 3:167864638-167864660 CATAGGCAGGAGCATTAATCTGG - Intergenic
966109499 3:176381817-176381839 CAGATGAGAGGGGATTTATCTGG + Intergenic
970173630 4:13314429-13314451 CATAGGAAGTGCCATTTATGAGG - Intergenic
970376871 4:15467602-15467624 CTGAGGAATGGGCATTTTTCAGG + Intergenic
971220928 4:24705457-24705479 CAGAGGAAGTGGCATTTACCTGG + Intergenic
972015677 4:34241987-34242009 CAGGGCAAGGGGGATTTACCTGG + Intergenic
972814777 4:42631944-42631966 GTGAGGAAGGCGCATATATCTGG - Intronic
975634710 4:76436115-76436137 CAAGGGAAGGTACATTTATCTGG + Exonic
975876252 4:78840405-78840427 CAGAGGGAGGGACAATGATCAGG - Intronic
978142673 4:105335444-105335466 CAGAGGCATGGGCATTTAGAAGG + Intergenic
978143146 4:105340500-105340522 CAGAGGCATGGGCATTTAGAAGG - Intergenic
980000924 4:127487088-127487110 CAGATGAAGGAGCATTCATGTGG + Intergenic
980444717 4:132889018-132889040 CAGGGGGAGGGACAATTATCGGG + Intergenic
981070733 4:140534866-140534888 CAGAGGAAGTGACATTGAACTGG + Intronic
981681995 4:147409856-147409878 GAGAGGAAGGGGCATGGATGTGG - Intergenic
983217080 4:165011671-165011693 CAGAGGAATTGGCATTTATCTGG + Intergenic
985648059 5:1094421-1094443 CAAAGAAAGGGGCATTTCCCAGG + Intronic
985692480 5:1321115-1321137 CAGAGGAAAGGGCAATGCTCAGG - Intronic
987381680 5:17291274-17291296 CAGAGGAGAAGGTATTTATCTGG + Intergenic
987926507 5:24349360-24349382 CAGTTGAAGGGGCACTTACCTGG - Intergenic
988099707 5:26660525-26660547 CAGAGGGAGGGACAATGATCAGG - Intergenic
990539889 5:56761656-56761678 CAGAGAAAAGGGCTTTTATTTGG + Intergenic
992172299 5:74115625-74115647 GAGAGGAAGGGGCTATTATAGGG - Intergenic
993611586 5:90060869-90060891 CAGAGGAAGAGGCAGGTAGCAGG - Intergenic
995368869 5:111395859-111395881 CCCAGGGAGGGGTATTTATCAGG + Intronic
996923103 5:128791388-128791410 CAGAGGAAGGATCATTAATAGGG - Intronic
998495712 5:142587579-142587601 CAGAAGAAGGGGCATTTCTTTGG + Intergenic
998826501 5:146106942-146106964 CTGAGGCAGGGGCATGTAGCTGG - Intergenic
999018324 5:148133961-148133983 CTGAGTAATGGACATTTATCTGG + Intronic
1000095427 5:157967190-157967212 CAGCGGAAGGGACAATGATCAGG + Intergenic
1001490817 5:172153894-172153916 CAGAGGAAGGGACATTTGAACGG - Intronic
1005814850 6:29542186-29542208 CTGGGGAAGGTGCATTTCTCAGG - Intergenic
1007172205 6:39871771-39871793 CAGATGAGAGGGCATTTATTAGG + Intronic
1007475508 6:42117088-42117110 CAGAGGAAGGGCATTTAATCTGG - Intronic
1008466162 6:51833064-51833086 TAGAGTAAGGGGTATTTGTCAGG + Intronic
1008789308 6:55210663-55210685 CACAGGAAGGGACAGTGATCAGG - Intronic
1016429804 6:143971233-143971255 TAGAGGAAGGGGCATTTGTATGG - Intronic
1018003523 6:159600084-159600106 CAGAGGCAGGGGCTTTTAGGAGG + Intergenic
1018457714 6:163966944-163966966 TAAAGGAAGCTGCATTTATCGGG + Intergenic
1021774830 7:24042705-24042727 CAGAGGAACATGCATTTAACAGG - Intergenic
1024412690 7:49064078-49064100 CAGAGGAAGGGGCTTTTCCCAGG + Intergenic
1025752795 7:64307733-64307755 CAGAGGAAGGGGCAGGGATGAGG - Intronic
1026697782 7:72611142-72611164 CAGAGGAGGCGCCATTTAACTGG - Intronic
1028650094 7:93141473-93141495 GAGTGGGAGGGGCATATATCAGG - Intronic
1030831950 7:114234912-114234934 CAGAGAAAGTGGCCTTTAACTGG - Intronic
1037571264 8:20159511-20159533 CAGAGGGAGGGACAATGATCGGG + Intronic
1038439123 8:27559405-27559427 TAGAGGAAGGGGAGATTATCTGG - Intergenic
1038461157 8:27718205-27718227 CAGAGGAGGGGGCAATTCTCTGG - Intergenic
1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG + Intergenic
1039782481 8:40798899-40798921 CATTGGAAGGGGCTTTTTTCAGG + Intronic
1039791403 8:40878786-40878808 CAGAGGAGGGGGCATCTCCCAGG - Intronic
1041798634 8:61773527-61773549 TGGAGGAAGCGGCATTTATTTGG - Intergenic
1043458299 8:80433885-80433907 CAGAGCAAGTAGCATTTATTTGG + Intergenic
1043561620 8:81500196-81500218 CAGTAGAAGGGTAATTTATCAGG - Intergenic
1048512389 8:135074729-135074751 CAGAGGCGGTGGCATTTAGCTGG + Intergenic
1048887672 8:138921463-138921485 CAGAGGAAGCAGTATTTATTTGG - Intergenic
1049077424 8:140410173-140410195 GAGAGGAAGTGGCACTTCTCTGG + Intronic
1049201904 8:141344425-141344447 CGGAGGAAGTGACATTTAGCTGG - Intergenic
1055431363 9:76247402-76247424 CAGAGGGAGGGACAATGATCAGG - Intronic
1057717100 9:97503285-97503307 AAGAAGAGGGGGCATTGATCGGG - Intronic
1058873040 9:109218808-109218830 AAGAGGAAGGGATCTTTATCTGG - Intronic
1059659326 9:116385992-116386014 CTGAGGAAGGGACATTTACATGG + Intronic
1060183149 9:121547541-121547563 CAGAGGAACGGGCATATACGAGG + Intergenic
1061703360 9:132433270-132433292 CAGAGCAAGTGCCATTTCTCAGG - Intronic
1062411884 9:136429880-136429902 CGGAGGAGGGGGCATTTAAGAGG + Intronic
1185721643 X:2387355-2387377 TATAGAAAGGGGCATTTATTCGG + Intronic
1187613796 X:20971683-20971705 CAGCGGAAGGGACAATGATCAGG + Intergenic
1187623304 X:21082866-21082888 CAAAGGAAGGGACATTTTTATGG - Intergenic
1190959079 X:55227774-55227796 AAGAGGAAAGAGCATTTTTCAGG + Intronic
1191166553 X:57398659-57398681 CAGAGGGAGGGACAATGATCGGG - Intronic
1192972395 X:76247103-76247125 CAAAGGCAGGGGTATTTAGCAGG - Intergenic
1193313182 X:80032316-80032338 TAGAGGAAGGCACATTTATAAGG - Intergenic
1193581000 X:83262541-83262563 CAGTGGGAGGGGCAATGATCAGG - Intergenic
1196206158 X:112942339-112942361 GAGAGGAAGGGGTATTATTCTGG + Intergenic
1200488209 Y:3791362-3791384 CAGGGGAAGAGGCATTTTTGTGG + Intergenic
1201905209 Y:19080140-19080162 CAGAGGAAGGGACAATGATCGGG + Intergenic