ID: 1145011559

View in Genome Browser
Species Human (GRCh38)
Location 17:19371145-19371167
Sequence CAGCAGCACTGGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 0, 2: 6, 3: 80, 4: 744}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145011551_1145011559 13 Left 1145011551 17:19371109-19371131 CCTGGCCACTGTGTGTGCTGACG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 80
4: 744
1145011552_1145011559 8 Left 1145011552 17:19371114-19371136 CCACTGTGTGTGCTGACGCAGAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 80
4: 744
1145011550_1145011559 14 Left 1145011550 17:19371108-19371130 CCCTGGCCACTGTGTGTGCTGAC 0: 1
1: 0
2: 1
3: 42
4: 326
Right 1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 80
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145011559 Original CRISPR CAGCAGCACTGGAGGGAGGG AGG Intronic
900289006 1:1915943-1915965 CAGCAGCAGTGGTGGCAGGCAGG + Intronic
900300207 1:1973335-1973357 CAGCAGTGCTGTGGGGAGGGAGG + Intronic
900406904 1:2496750-2496772 CAGCAGCATAGCAGGGATGGGGG - Intronic
900436974 1:2635422-2635444 CAGCAGCCCTGGGGCCAGGGTGG + Intergenic
900459721 1:2797080-2797102 CAGAAGCACAGTATGGAGGGCGG + Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900630704 1:3633685-3633707 CAGCAGGACACGAGAGAGGGTGG - Intronic
900640121 1:3684512-3684534 CCTGAGCACTGGAGGGAGTGGGG + Intronic
900735679 1:4298096-4298118 CAAGGGCATTGGAGGGAGGGAGG + Intergenic
900979384 1:6037755-6037777 CTGCAGCACTGGGGGGCTGGAGG - Intronic
901184858 1:7366371-7366393 GAGCAGCCCTGGAGAGAAGGGGG - Intronic
901254116 1:7806234-7806256 CAGCAGCACTGCAGGCAAGCAGG + Intronic
901262677 1:7885532-7885554 CAGCAGGAGTGGAGGCTGGGTGG - Intergenic
901526341 1:9825142-9825164 TGGCAGCACTGGAGGCTGGGTGG + Intergenic
901794196 1:11671174-11671196 CAGGAGGGCGGGAGGGAGGGTGG - Intronic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
902515117 1:16985994-16986016 CAGCAGCACTGAGGGGAGCTGGG + Exonic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903761900 1:25704205-25704227 CAGCAGGACTGGGGGCAGGAAGG - Intronic
903919513 1:26789296-26789318 CAGGAGGCCTGGAGGAAGGGAGG - Intronic
904081010 1:27872618-27872640 CCGCAGCACGCGCGGGAGGGAGG - Exonic
904246932 1:29194488-29194510 CAGGAGCACTGAATGGTGGGAGG + Intronic
904484200 1:30814160-30814182 CAGCCCCACTGGACTGAGGGTGG - Intergenic
904852079 1:33466958-33466980 CAGATGCACTGGTGGGACGGGGG + Intergenic
905289286 1:36910556-36910578 CAGCAGCAGTGGTGGGGGGGCGG + Intronic
905515278 1:38558094-38558116 CAGCAGCACTGGGGGTGGTGGGG + Intergenic
905731659 1:40302802-40302824 CAGTTGCTCTGGAGGGAGGGAGG + Exonic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
907443120 1:54490524-54490546 CAGGAGCCCTGCAGGGAGGGAGG - Intergenic
907575407 1:55521697-55521719 CATCAGAACTAGGGGGAGGGAGG - Intergenic
907921786 1:58920819-58920841 CACCAGCACTGGAGACAGTGAGG - Intergenic
909152896 1:72031282-72031304 CAAGAGCACTGGAGATAGGGAGG + Intronic
909791364 1:79681910-79681932 AAGAAGCAAGGGAGGGAGGGGGG + Intergenic
910351786 1:86307051-86307073 CAGGAGTACTGGAAGGAGGCTGG - Intergenic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
910766172 1:90784624-90784646 CATTAGCATTAGAGGGAGGGAGG + Intergenic
911002406 1:93180177-93180199 CAGCAGCACCGGAGGCAGAGCGG + Exonic
911553533 1:99314386-99314408 TAGCAGCTGTGGTGGGAGGGTGG - Intergenic
912179986 1:107208131-107208153 ATGCAGAAATGGAGGGAGGGTGG + Intronic
912701566 1:111882033-111882055 CAGCAGCTGTAGAGGGAGGCAGG + Intronic
914441529 1:147711768-147711790 CAGCAGCCCAGCAGGGAGAGGGG - Intergenic
914890066 1:151613601-151613623 CTGCAGCAGGGGAGAGAGGGTGG - Intronic
915318820 1:155044815-155044837 CAGGAAGTCTGGAGGGAGGGCGG + Intronic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
916710472 1:167401513-167401535 CAGCAGCACTGGTCAGAGGGAGG - Exonic
917469979 1:175318180-175318202 CAGAAGCTCTGGTGGGAGGCTGG + Exonic
917600695 1:176570915-176570937 CAGCAGCAGTGTAGGGAGGCAGG - Intronic
917737603 1:177934817-177934839 AAGGAGGAATGGAGGGAGGGAGG + Intronic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918121862 1:181547305-181547327 GAGCACCACTGGAGTTAGGGTGG - Intronic
918177772 1:182060486-182060508 CAGAAGCCATGGATGGAGGGAGG + Intronic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
918441975 1:184576717-184576739 CATGAGAACTGGAGGTAGGGAGG - Intronic
919142946 1:193596148-193596170 CAGCAGCATTTAAGAGAGGGAGG + Intergenic
920186783 1:204164461-204164483 CAGCAGTCCTGAAGGTAGGGAGG - Intronic
920418119 1:205812470-205812492 CAGGAACACAGGAGGGAGGCGGG - Intronic
921036330 1:211382677-211382699 CTGCTGGACTGGAGGGAGGGAGG - Intergenic
921285061 1:213602201-213602223 AAGAAGGAATGGAGGGAGGGAGG - Intergenic
922938595 1:229440504-229440526 CAGCAGCACGGGAGGGAGATGGG + Intergenic
923046214 1:230357425-230357447 CGGTAGCACTGGAGGCAGCGGGG - Intronic
923141059 1:231162087-231162109 CAGCGGCAGCGGCGGGAGGGAGG + Intergenic
924627723 1:245709752-245709774 CAGAAACACTGGACTGAGGGAGG - Intergenic
1062799957 10:371633-371655 GAGCAGCACCCGAGGGAGGCTGG + Intronic
1062799969 10:371676-371698 GAGCAGCACCCGAGGGAGGCTGG + Intronic
1062896381 10:1106335-1106357 GAGCAGCACTGGTGGGAGGTAGG - Intronic
1063114544 10:3064524-3064546 CAGCAACACAGGAGTGAGCGTGG + Intergenic
1063200382 10:3781564-3781586 CACCAGCCCTGGAGGGAGCCGGG - Intronic
1063685280 10:8231136-8231158 CAGCAGCACAGGAAGGAAGCAGG + Intergenic
1064598053 10:16966084-16966106 CAGCAGCTCTGGAAATAGGGTGG + Intronic
1065025158 10:21534308-21534330 CAGGCGCACTGGGGGGAGGGGGG - Intronic
1065485987 10:26237064-26237086 CTGCAGCACTAAAGGAAGGGAGG - Intronic
1065872932 10:29971480-29971502 CAGGAGCACGAGAGAGAGGGGGG + Intergenic
1066065604 10:31759432-31759454 CGGAAGCACGGGAGGGAGTGCGG + Intergenic
1068944733 10:62718446-62718468 CAAGATCACTGGAGGGAAGGAGG - Intergenic
1069622536 10:69846680-69846702 TGGGAGCACTGGAGGGAGGAAGG - Intronic
1069881513 10:71596617-71596639 CTGCCACACTGGAGGGAGAGGGG - Intronic
1069935456 10:71912597-71912619 CAGCAGCTAGGGATGGAGGGAGG - Intergenic
1070647369 10:78211175-78211197 AGGCACCCCTGGAGGGAGGGAGG + Intergenic
1070653474 10:78254638-78254660 CAGCTGCACTGTAAAGAGGGAGG + Intergenic
1070749435 10:78955259-78955281 CAAGAGCAATGGTGGGAGGGAGG + Intergenic
1070751259 10:78965310-78965332 CAGCAGCACTGGGGGCAGGGCGG + Intergenic
1071167361 10:82822375-82822397 CAGCAGCCCAGCAGGGAGAGAGG + Intronic
1071256585 10:83877258-83877280 CATCTGCAGTGGAGGGATGGGGG - Intergenic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1072780134 10:98244761-98244783 CAGCTGCACTGCAGCCAGGGGGG + Exonic
1073026140 10:100488606-100488628 CAGGGGTACTGGAAGGAGGGTGG - Intronic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1074440680 10:113475042-113475064 CAGCAGTGGTGGAGGGAGGTGGG + Intergenic
1075019766 10:118943425-118943447 CAGCTGCAAGGGAGGCAGGGTGG - Intergenic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1075333629 10:121593514-121593536 CCGCAGCACTGCAGGCAGGATGG - Intronic
1075403385 10:122177298-122177320 AAGGAGCAGTGGAGGGAGGCTGG + Intronic
1075641174 10:124065591-124065613 CAGCAGGACTGGCGGGGGAGGGG - Intronic
1076058977 10:127398481-127398503 CAGCAGCACAGGAGCCAGGGAGG - Intronic
1076108991 10:127846658-127846680 CAGCATCACTGGGAGAAGGGAGG - Intergenic
1076139685 10:128069179-128069201 GAGCTACACTGGAGGGTGGGTGG - Intronic
1076168996 10:128304605-128304627 CACCAGCAGTGGATGGAGGAGGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076631288 10:131853576-131853598 CAGGAGAAATGGAGGGAGAGGGG - Intergenic
1076642413 10:131927640-131927662 GAGCTGCCCCGGAGGGAGGGAGG - Intronic
1076725361 10:132410550-132410572 CAGCACCACTGCAGGGGAGGGGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077485133 11:2835038-2835060 CAGAAGCGGGGGAGGGAGGGAGG + Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1077679538 11:4225816-4225838 CTGCAGCACTGTAGGTAGAGAGG - Intergenic
1077681949 11:4250091-4250113 CTGCAGCACTGTAGGTAGAGAGG + Intergenic
1077688953 11:4322396-4322418 CTGCAGCACTGTAGGTAGAGAGG - Intergenic
1078149979 11:8750282-8750304 AAGCTGCACTGTAGTGAGGGAGG - Intronic
1078156686 11:8805966-8805988 CAGAAGCACTGGAGGGGGTAGGG - Intronic
1078337837 11:10477746-10477768 CAGCAGGGCTGGAGGCTGGGTGG + Intronic
1079082983 11:17427147-17427169 CAGCTGGCCTGCAGGGAGGGAGG + Exonic
1079137025 11:17781180-17781202 CAGAAGCACAGAAGGGAGTGTGG + Intronic
1079636124 11:22743611-22743633 TTGTAGCAGTGGAGGGAGGGAGG - Intronic
1080030025 11:27650518-27650540 CACCAGCTATGGAGGGAGGCAGG + Intergenic
1080225710 11:29957607-29957629 CAGAATCCCTGGAGAGAGGGAGG - Intergenic
1080616260 11:33947418-33947440 CAGCTGGAATGAAGGGAGGGAGG - Intergenic
1081024830 11:37998344-37998366 GAGCAGCACTGAAAGGACGGTGG + Intergenic
1082847954 11:57741548-57741570 CAGCGGGACTGGTGGGTGGGGGG - Intronic
1082849849 11:57754834-57754856 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083452010 11:62752588-62752610 CAGCAGGACTGGAGGAGGTGGGG - Exonic
1083458370 11:62794314-62794336 CTGCTGCTCTGGAGAGAGGGTGG + Exonic
1083487016 11:62989651-62989673 AAGCAGCAATGGAGAGAAGGAGG + Intronic
1083855200 11:65389804-65389826 CAGTACCGCAGGAGGGAGGGAGG + Intronic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084642204 11:70432685-70432707 GAGCAGCACAGGCAGGAGGGTGG + Intronic
1084674466 11:70626010-70626032 CAGCGGAACTGGAGGCGGGGAGG - Intronic
1084982916 11:72841536-72841558 CAACGGCAGTGGAGGCAGGGAGG + Exonic
1085205234 11:74727737-74727759 AAGCAGGATTGGATGGAGGGAGG + Intronic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1085640434 11:78189472-78189494 CGGGTGCACTGGAGGGAGGGAGG + Intronic
1085698800 11:78728477-78728499 CAGAAGCAAGGAAGGGAGGGAGG - Intronic
1086063549 11:82724049-82724071 ATCCAGCAGTGGAGGGAGGGTGG - Intergenic
1086888260 11:92226829-92226851 CAGCAGCCGCGGCGGGAGGGAGG + Intergenic
1087841732 11:102927661-102927683 GACCAGCACAGGAGGCAGGGAGG + Intergenic
1087875038 11:103344928-103344950 CAGCAGAACGGGAGGGAGACTGG - Intronic
1088168558 11:106967773-106967795 AAGCAGGAAGGGAGGGAGGGAGG + Intronic
1088764322 11:112961829-112961851 GCGCAGCCCTGGAGGGAGCGGGG - Intronic
1088886914 11:114015053-114015075 CAGGTGCACTGGAAGGGGGGAGG + Intergenic
1088893954 11:114064086-114064108 CAGCATCTCAGGAGGGATGGGGG + Exonic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089180183 11:116578238-116578260 AAGAAGAAATGGAGGGAGGGAGG - Intergenic
1089282015 11:117381370-117381392 CACCAGCACTGGGGCCAGGGAGG - Intronic
1089780409 11:120869728-120869750 CAGCCTCACTGGAGGAAGAGGGG + Intronic
1089966684 11:122659334-122659356 GAGCAGGCCTGGAGAGAGGGAGG + Intronic
1090250993 11:125251697-125251719 CAGCAGGAATGGAGGAAGAGAGG - Intronic
1091753000 12:3034142-3034164 CAGCAGTGCTAGAGGCAGGGGGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1092013727 12:5139138-5139160 CAGCAGCCCTGGAGAGCAGGAGG + Intergenic
1092083419 12:5736540-5736562 CTTGGGCACTGGAGGGAGGGAGG - Intronic
1092164788 12:6336220-6336242 GAGCCTCCCTGGAGGGAGGGAGG + Intronic
1093989371 12:25572807-25572829 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095956294 12:47808324-47808346 CAGCAGAAGTGGAGGTGGGGTGG - Intronic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1099206041 12:79727601-79727623 CACCACCACAGTAGGGAGGGAGG - Intergenic
1099252122 12:80269399-80269421 CAGCAGCATTGAAGATAGGGTGG - Intronic
1100457753 12:94768716-94768738 AAAGAGCACTGAAGGGAGGGAGG - Intergenic
1100493525 12:95103531-95103553 CAGAAAGAATGGAGGGAGGGCGG - Intronic
1102004536 12:109580885-109580907 AGGCAGCGGTGGAGGGAGGGAGG + Intronic
1102046477 12:109833079-109833101 TAGCAGGTCTGGGGGGAGGGCGG - Intronic
1102495668 12:113317219-113317241 CAGCTACTCGGGAGGGAGGGAGG - Intronic
1102571911 12:113831893-113831915 CTGCAGCAGTGCAGGGAGGCTGG - Intronic
1102637785 12:114339440-114339462 CTGGAGCAGTGGAGGGCGGGAGG + Intergenic
1103328349 12:120136703-120136725 CCGCAACACTGGAAGGATGGAGG + Exonic
1103495316 12:121357584-121357606 CAGAAAGAATGGAGGGAGGGAGG + Intronic
1103954528 12:124568712-124568734 AAGCAGAAGAGGAGGGAGGGAGG - Intergenic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104657200 12:130582119-130582141 CAGCAGAGGAGGAGGGAGGGAGG - Intronic
1104720113 12:131040665-131040687 AGGCAGCTCTGGAGGGCGGGTGG - Intronic
1104747787 12:131221001-131221023 CTGCCACCCTGGAGGGAGGGAGG - Intergenic
1104788116 12:131464208-131464230 CACCAGCACTGAAGGCAGGCAGG + Intergenic
1104898523 12:132175823-132175845 CGGCAGCCCTGGGGGGTGGGGGG - Intergenic
1105254189 13:18729891-18729913 CAGCAGTGCTTGAGGGTGGGGGG - Intergenic
1105694408 13:22873592-22873614 CAAAAGGAATGGAGGGAGGGAGG - Intergenic
1105756645 13:23471012-23471034 CAACAGGGTTGGAGGGAGGGAGG + Intergenic
1106999602 13:35527505-35527527 CAGGAGCTCAGGAGGGAGGCTGG - Intronic
1110290879 13:73805603-73805625 CAGAAGGAAGGGAGGGAGGGAGG + Intronic
1110461402 13:75749576-75749598 CAGCAGCAGGTCAGGGAGGGAGG - Intronic
1112229887 13:97578803-97578825 CAGCAGAAAGGGAGGGAGAGGGG + Intergenic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1113069523 13:106406927-106406949 GAGCAGGACAGGAGGGAGGGAGG - Intergenic
1113198057 13:107832789-107832811 CAGCAGCACTGTAGGAAGGAAGG - Intronic
1113439759 13:110319095-110319117 CAGCAGGACTGGTGGGTGCGGGG + Intronic
1113462798 13:110493563-110493585 CAGCAGCACCGTTGGGAGGGTGG + Intronic
1113467948 13:110525213-110525235 TAGCAGCGCTAGAGGGAGGCTGG + Intronic
1113603578 13:111588667-111588689 ATGCAGCTCTGTAGGGAGGGAGG + Intronic
1113808761 13:113124546-113124568 CAGCTGCACTGTGGGGTGGGTGG + Intronic
1113901205 13:113799158-113799180 CAGCTGCTCTGCAGGGAGCGTGG + Intronic
1114541484 14:23463349-23463371 CAGGATCACTTGAGGCAGGGAGG + Intergenic
1114711756 14:24785769-24785791 CAGCTGCAGAGGTGGGAGGGAGG + Intergenic
1114773562 14:25455969-25455991 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1114774152 14:25461846-25461868 CAGCAGCATTGAGGGCAGGGGGG - Intergenic
1114846290 14:26326746-26326768 TAACAGCATTGGATGGAGGGAGG - Intergenic
1114876891 14:26731424-26731446 CAGCAGTAATGGAGGCAGTGGGG + Intergenic
1118466663 14:66037507-66037529 CTGCCGCACTGGAGGAAGAGAGG - Intergenic
1119159591 14:72441846-72441868 CCCCAGCAGTGGAGGGATGGGGG + Intronic
1120635556 14:86946382-86946404 GAGAGGGACTGGAGGGAGGGAGG - Intergenic
1120666361 14:87311202-87311224 CGGAAGGACGGGAGGGAGGGAGG - Intergenic
1120869957 14:89328339-89328361 CAGCAGCCCTGGATGAATGGGGG + Intronic
1120869996 14:89328529-89328551 CAGCAGCCCTGGATGAATGGGGG + Intronic
1121020253 14:90575573-90575595 CTGCAGCACCAGTGGGAGGGGGG + Intronic
1121026267 14:90618643-90618665 CAGAAGGTCTGGATGGAGGGTGG - Intronic
1121283292 14:92714835-92714857 CAGGAGGCCTGGAGGGGGGGAGG - Intronic
1121328535 14:93035583-93035605 AAACAGGACGGGAGGGAGGGAGG + Intronic
1121398043 14:93644820-93644842 CAAAAAAACTGGAGGGAGGGAGG - Intronic
1121586654 14:95067577-95067599 CAGCAGCATGAGGGGGAGGGTGG + Intergenic
1121769118 14:96516397-96516419 TAGGAGCCCAGGAGGGAGGGAGG - Intronic
1122141786 14:99667089-99667111 CAGCTGGACTGGGGGCAGGGAGG - Intronic
1122169453 14:99859979-99860001 CAGCAGCCCTGCAAGGTGGGTGG + Intronic
1122258688 14:100499737-100499759 CAGGAGCTCTGGAAGGAAGGAGG - Intronic
1122262249 14:100530331-100530353 CAGCAGGCCTGGGAGGAGGGAGG - Intergenic
1122268971 14:100559886-100559908 CAGCAGCAATGTTTGGAGGGAGG + Intronic
1122428195 14:101623770-101623792 CCTAAGCCCTGGAGGGAGGGAGG - Intergenic
1122623573 14:103073171-103073193 AAGCAAGAGTGGAGGGAGGGAGG + Intergenic
1122802256 14:104237618-104237640 TAGCAGCACTGGAAGGTGGTGGG - Intergenic
1122900733 14:104781370-104781392 CAGCAGGACTGGGTGGTGGGTGG - Intronic
1122971436 14:105153830-105153852 CAGCAGCCATCCAGGGAGGGTGG + Intronic
1123023116 14:105411482-105411504 CAGCTGCACTGCAGGGTGCGCGG + Exonic
1123435605 15:20251868-20251890 CAGGAGCACTGGAAGTAGCGGGG - Intergenic
1124892357 15:33744981-33745003 CAGCAAGACTGGAGGCTGGGAGG + Intronic
1125213366 15:37240666-37240688 AAGGAGGAATGGAGGGAGGGTGG + Intergenic
1125327410 15:38549868-38549890 CAGCAGCACAGAAGAGATGGTGG - Intronic
1125608541 15:40956063-40956085 CAGCAGCACTGGGGGGAATCTGG - Exonic
1125925644 15:43560588-43560610 CAGCAGCTCTGGACGGGGTGAGG + Intronic
1125938789 15:43660139-43660161 CAGCAGCTCTGGACGGGGTGAGG + Intronic
1126506139 15:49406546-49406568 CAGCAGCTTTGGCGGGAGGGTGG + Intronic
1128457996 15:67843716-67843738 CAGCCCCACCGGAGGGAAGGAGG + Intergenic
1128707383 15:69846848-69846870 CTGCAGCCCTGTAAGGAGGGTGG - Intergenic
1129107974 15:73322254-73322276 ACTCAGCACTAGAGGGAGGGAGG - Exonic
1129170234 15:73803088-73803110 CAGCAGCACTTGAGGCTGGTCGG - Intergenic
1129407325 15:75328188-75328210 GAGCTGCTCTGGAGGCAGGGAGG - Intergenic
1129482193 15:75835854-75835876 CAGCATCACTGGAGTCAGGAGGG + Intergenic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1129848436 15:78778637-78778659 CAGAAACAATGGAGGGAGGCAGG + Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129901523 15:79154813-79154835 CAGGAGCATTGGGGGGAAGGAGG + Intergenic
1130540710 15:84819031-84819053 CAGCAGCAATGAAGGAAGGGAGG + Intronic
1130956464 15:88630469-88630491 CAACAGCCCTGGAGAGAGAGAGG - Exonic
1131419391 15:92291667-92291689 CAGGAACAAGGGAGGGAGGGAGG + Intergenic
1132244598 15:100284581-100284603 CAGGAGCACTGAGGGGTGGGAGG + Intronic
1132353936 15:101157832-101157854 GGGCAGCACTGGAGGGAGCCAGG + Intergenic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132496206 16:264654-264676 CAGCAGCACGCGCGGCAGGGTGG - Exonic
1132617257 16:847844-847866 CCGCAGCCCTGCAGGGAGGGTGG + Intergenic
1132731951 16:1367040-1367062 CAGCAGCCCTGCAGGCAGGCTGG + Intronic
1132733846 16:1376067-1376089 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733867 16:1376129-1376151 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733899 16:1376227-1376249 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733911 16:1376257-1376279 CCCCAGCCCTGGAGAGAGGGAGG - Intronic
1132733923 16:1376299-1376321 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132733946 16:1376369-1376391 CCCCAGCCCTGGAGGGAGGAGGG - Intronic
1132943374 16:2519433-2519455 CTGGAGGACTGCAGGGAGGGGGG + Intronic
1133269000 16:4601579-4601601 CAGGAGCATTGTTGGGAGGGGGG - Intergenic
1133528650 16:6631793-6631815 CAGCAGCTCTGCAGGGGGCGGGG + Intronic
1133814160 16:9183802-9183824 CAGCAGGATTGGGGGGGGGGGGG - Intergenic
1133839264 16:9394041-9394063 AAGCAGGAAGGGAGGGAGGGAGG - Intergenic
1133839435 16:9394556-9394578 AAGCAGGAAGGGAGGGAGGGTGG - Intergenic
1133839447 16:9394588-9394610 AAGCAGGAAGGGAGGGAGGGTGG - Intergenic
1133969545 16:10557896-10557918 CATCAGAACTGGAGAGAGTGGGG + Intronic
1134754021 16:16650613-16650635 CAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1134992038 16:18708431-18708453 CAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1135182559 16:20288399-20288421 CAGCAGCACTTGAAGGCAGGTGG - Intergenic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1135944637 16:26855099-26855121 CAGCATCACTGGGGCCAGGGAGG + Intergenic
1136294172 16:29292201-29292223 CAGCAGTACTGGAGCTATGGGGG + Intergenic
1136617693 16:31408642-31408664 CAGGAGCACAGCAGGGAGGAGGG + Intronic
1137505502 16:49050807-49050829 AAGAAGCACTGGAAAGAGGGTGG + Intergenic
1137664605 16:50242412-50242434 GAGCACCACTGGAGGAAGTGTGG + Intergenic
1137670647 16:50276309-50276331 CAGCAGCACTGGGGGTGAGGAGG - Intronic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1137721712 16:50631378-50631400 CAGCTGCAAGGGAGGAAGGGAGG + Intronic
1137878507 16:52021254-52021276 AGGCAGAAATGGAGGGAGGGTGG - Intronic
1137982987 16:53085483-53085505 CAGCATCAATGGGGGCAGGGAGG - Intronic
1138699820 16:58850764-58850786 CAGCAGCATGGTAGGGATGGAGG - Intergenic
1139512738 16:67436639-67436661 CAGCAGCTCTTGAGGCAGGTTGG - Exonic
1140092477 16:71849845-71849867 AAGCATCACTGGAGGGTGTGTGG - Exonic
1140143604 16:72284425-72284447 CAGCAGATCTGGAAGGATGGAGG - Intergenic
1140482186 16:75267629-75267651 CAGGAGCAAGGGAGGGAGGTGGG - Intronic
1140523554 16:75603076-75603098 CAGCATCACCTGAGGGAGTGTGG + Exonic
1140970988 16:80012202-80012224 TAGCAGCACGGGAGGTATGGGGG + Intergenic
1141088457 16:81113445-81113467 CTGCAAGACTGGAGGGAGGCAGG + Intergenic
1141234107 16:82199599-82199621 CTGCATCACTGGAGGAAGTGTGG + Intergenic
1141503762 16:84461829-84461851 CAGCAGCTCTGCAGCGAGGAGGG - Intronic
1141506455 16:84481525-84481547 CTGCTGCCCTGGAGAGAGGGAGG - Intronic
1141562508 16:84878941-84878963 CAGCTGCCCTGGAGGCTGGGTGG + Intronic
1141598750 16:85112754-85112776 CAGCTTCCCTGAAGGGAGGGAGG - Intergenic
1141645479 16:85365132-85365154 GAGGAGCTCTGGAGGGTGGGTGG - Intergenic
1141746901 16:85931945-85931967 CAACAGCACCGGAAGGCGGGAGG + Intergenic
1142069353 16:88082452-88082474 CAGCAGCAATGAAGGCAGGCAGG - Intronic
1142100076 16:88266247-88266269 CAGCACCACTGGAGCTATGGGGG + Intergenic
1142151765 16:88515648-88515670 CAGCAGCCCTGCAGGAGGGGTGG + Intronic
1142182287 16:88677102-88677124 GAGCAGGACTCCAGGGAGGGGGG + Intergenic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1142680094 17:1542433-1542455 AAGCAGGAAGGGAGGGAGGGAGG - Intronic
1142850196 17:2701056-2701078 CAGAAGCACTGGAGTGCAGGTGG + Intronic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1143437434 17:6939739-6939761 TAGCAGGGCTGGAGGGAGAGTGG + Intronic
1143790495 17:9291330-9291352 CAGCTACTCAGGAGGGAGGGAGG + Intronic
1144130686 17:12243637-12243659 CAGAAGAAATGGAGTGAGGGTGG + Intergenic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1146391620 17:32428472-32428494 CAGCAGCCCTGGTTGGAGGAGGG + Intergenic
1146566222 17:33915341-33915363 GAACAGCCCTGGAGGGAGGTGGG - Intronic
1146740845 17:35282308-35282330 TAGCAGTGCTGGAGTGAGGGGGG + Intergenic
1147987422 17:44314665-44314687 TAGCAGCTCTGGGGGGGGGGGGG + Intronic
1148142356 17:45337912-45337934 CAGCAGCAGTGTGAGGAGGGAGG + Intergenic
1148554535 17:48570443-48570465 CAGCAGCTCTGGAGGCAGCCAGG + Intronic
1148699577 17:49579516-49579538 CAGGAGCACTGGAGGAGGAGTGG + Exonic
1148790385 17:50169309-50169331 AAGCAGCATGGGAGGGAAGGGGG - Intronic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149656645 17:58312625-58312647 GGCCAGCTCTGGAGGGAGGGAGG + Exonic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1150303356 17:64064176-64064198 CAGGAGCCCTGGAGGGAGAGCGG + Intronic
1150578974 17:66454986-66455008 AGGCAGCAGTGGAGGGAAGGTGG + Intronic
1151169735 17:72236584-72236606 AGGCAGGACGGGAGGGAGGGAGG + Intergenic
1151336074 17:73440535-73440557 GTACAGGACTGGAGGGAGGGTGG - Intronic
1151364707 17:73609742-73609764 CCAAAGCACAGGAGGGAGGGAGG + Intronic
1151678000 17:75609707-75609729 CATCAGGAAGGGAGGGAGGGAGG - Intergenic
1151715144 17:75827483-75827505 CAGCTGCCCTGGGGGGAGGGTGG - Exonic
1151771844 17:76168287-76168309 CAGCTACACTGGGGGGATGGCGG - Intronic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152259851 17:79260988-79261010 CCCCAGGACGGGAGGGAGGGAGG - Intronic
1152287722 17:79422352-79422374 TGGCAGCACAGGACGGAGGGAGG - Intronic
1152336166 17:79701181-79701203 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336201 17:79701271-79701293 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336220 17:79701325-79701347 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336231 17:79701355-79701377 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336310 17:79701557-79701579 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336343 17:79701647-79701669 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152420306 17:80189220-80189242 CAGGTGCACTGGAGAGAGGGGGG + Intronic
1152527355 17:80896244-80896266 GAGAAGCACTGGCGGGAGGACGG - Intronic
1152537681 17:80960011-80960033 CTGCAGGACAGCAGGGAGGGTGG + Intronic
1152588406 17:81199282-81199304 CAGCAGCACAGGAGGCCGAGAGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152671844 17:81612937-81612959 CAGCTGCAGGGGAGGGAGGAGGG - Intronic
1152719710 17:81917602-81917624 AATCAGCACGGTAGGGAGGGAGG - Exonic
1152727742 17:81955952-81955974 CAGCAGCACTGCAGGGGGCCTGG - Intronic
1153486213 18:5601326-5601348 TAGCAGCATTGGAGGGAGGTAGG - Intronic
1154123275 18:11668915-11668937 CAGCAGGAAGGAAGGGAGGGAGG + Intergenic
1154219692 18:12441158-12441180 CACTTGAACTGGAGGGAGGGGGG + Intergenic
1154268337 18:12898088-12898110 GAGCAGCAGTGCAGGGAAGGAGG - Intronic
1154309941 18:13259696-13259718 CAGCACAAATGGAGGGAGGGAGG - Intronic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1156034878 18:32754960-32754982 CTGCAGCAAGGGAGGGAGGCAGG + Intronic
1156551404 18:38022742-38022764 GAGAGGCAGTGGAGGGAGGGAGG - Intergenic
1157301782 18:46484665-46484687 CAGCAGTCCTGGAGAGAGTGAGG + Intronic
1157846323 18:51007028-51007050 CAGCTGCATTGCAGGGCGGGCGG - Intronic
1158200707 18:54936581-54936603 CATGAGCACAGGTGGGAGGGAGG - Intronic
1159289323 18:66395968-66395990 CAGCAGCTGTGGAGGGTGCGCGG + Intergenic
1159418804 18:68188101-68188123 CAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1160272596 18:77401337-77401359 CAGCTGCAATGGGGGGCGGGTGG + Intergenic
1160555882 18:79724875-79724897 AAGCAGCCATGGAGGGAGGACGG - Intronic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160870766 19:1276794-1276816 CAGCAGCCCGGGAGGCAGGGAGG - Intronic
1160875290 19:1293943-1293965 CAGCAGCTCGAGAGAGAGGGTGG - Intronic
1161052723 19:2173337-2173359 AAGCAACACAGGAGGGAGGCTGG - Intronic
1161059660 19:2208533-2208555 CAGCAGCACTGCGTGGAGGTGGG - Intronic
1161451153 19:4346120-4346142 CCCCAGCCCTGGAGGGATGGAGG - Intronic
1161452183 19:4352761-4352783 CATGACCACTAGAGGGAGGGAGG - Intronic
1162119744 19:8456324-8456346 TAGCAGCACAGGAGGGAAGAAGG - Intronic
1162338970 19:10080020-10080042 AAGAAGGAATGGAGGGAGGGAGG + Intergenic
1162536020 19:11262960-11262982 CTGAAGCTCAGGAGGGAGGGAGG + Intergenic
1162601566 19:11674004-11674026 CAGGCGCACTGCAGGGAGGTGGG + Intergenic
1162690101 19:12422639-12422661 TAGAAGCACTGGATGGAGGTTGG + Intronic
1162728992 19:12706360-12706382 CAAAAGCACTGGTGGGAGGGAGG + Exonic
1163203762 19:15787481-15787503 AAGCAGCAAAGGAAGGAGGGAGG + Intergenic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163538471 19:17892308-17892330 AAGCAGGAAGGGAGGGAGGGAGG + Intronic
1163686246 19:18713572-18713594 CAGTAACATTGGAGGGAGGAGGG - Intronic
1163842539 19:19620033-19620055 CAGCAGCAATGGAGAGAACGTGG - Intergenic
1164478960 19:28596972-28596994 TAGCAGCACGGCAGTGAGGGTGG + Intergenic
1165031764 19:33002738-33002760 CAGGAGCACTGGAAGTAGCGGGG - Intronic
1165743238 19:38216064-38216086 GTGCAGACCTGGAGGGAGGGAGG - Intronic
1165924930 19:39320908-39320930 CTGCGGCTCGGGAGGGAGGGCGG - Intergenic
1166089942 19:40502321-40502343 GCCCAGCTCTGGAGGGAGGGTGG + Intronic
1166255422 19:41601000-41601022 CAGAGGCACTGAAGGAAGGGAGG + Intronic
1167066527 19:47190470-47190492 TAGCAGCAGTGGAGGGGGGCAGG - Intronic
1167294019 19:48639051-48639073 CATCTGCAGTGGAAGGAGGGTGG + Exonic
1167723076 19:51192258-51192280 CAGCAGCTCAGGAAGGAGGGAGG + Intergenic
1167761123 19:51450006-51450028 CAGCAGCTCAGGAGGGACAGAGG - Intergenic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168147299 19:54426902-54426924 GAGCAGCCCAGGAGGGAGGCGGG + Intronic
1168507999 19:56952493-56952515 CAGCAGGACGTGAGGGTGGGTGG - Intergenic
1168643098 19:58042844-58042866 CAGCGGCCCTGGTGGGAGAGGGG - Intronic
924962675 2:47517-47539 CAGCAGCCCGGAAGGCAGGGAGG + Intergenic
925173524 2:1767136-1767158 CAGCAGCCCATGAGGCAGGGTGG - Intergenic
925203519 2:1988106-1988128 CAGCTGGGCTGGCGGGAGGGTGG - Intronic
925203533 2:1988159-1988181 CAGCTGGGCTGGCGGGAGGGTGG - Intronic
925210660 2:2042953-2042975 CAGCAGCACTGCACCGGGGGTGG + Intronic
925360714 2:3278440-3278462 GAGCAGCTCTGCACGGAGGGAGG - Intronic
925385539 2:3459461-3459483 GAGCTGCCCTGGGGGGAGGGTGG - Intronic
925609163 2:5690393-5690415 GAACACCACCGGAGGGAGGGTGG - Intergenic
925910106 2:8568237-8568259 CAGCAAAAAGGGAGGGAGGGAGG + Intergenic
925915362 2:8600637-8600659 CAGCAGCACTGTCTGGAGGAAGG - Intergenic
926232726 2:11017133-11017155 CACAAGCACTGGAGGGCTGGGGG + Intergenic
926426536 2:12743623-12743645 CAGCAGCACTCTATGCAGGGAGG + Intergenic
927472740 2:23387082-23387104 CGCAAGCACGGGAGGGAGGGAGG - Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928405451 2:31011051-31011073 CAGAAGCACAGGAAGGAGGGAGG + Intronic
928432769 2:31234388-31234410 CAGCAGCCCAGGCCGGAGGGAGG - Exonic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
928939619 2:36714526-36714548 CCATGGCACTGGAGGGAGGGGGG + Intronic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929502841 2:42504920-42504942 CAGCATGACTGGAGTGAGGCTGG - Intronic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
929610440 2:43266935-43266957 AAGGAGCAATGGCGGGAGGGAGG - Intronic
930236221 2:48891233-48891255 AAGCAGGAAGGGAGGGAGGGAGG - Intergenic
930432520 2:51297726-51297748 CAGCAATATTGGAGGAAGGGAGG + Intergenic
930751580 2:54939644-54939666 CAGGGGCACTGCAGGGAGCGGGG - Intronic
930755185 2:54966377-54966399 GAGAAGCACTGCAGGGAGAGAGG + Intronic
931386485 2:61802344-61802366 CCAAATCACTGGAGGGAGGGCGG - Intergenic
931849250 2:66236282-66236304 CAGGAGCAATGGACTGAGGGGGG + Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932171182 2:69557896-69557918 CAACAGCCCAGGAGGTAGGGAGG - Intronic
932423584 2:71615287-71615309 CAGCAGCACTGGTGGGAGCTGGG + Intronic
933656206 2:84888981-84889003 CAGCAGCACGGAAGGGAAGCTGG + Intronic
933726475 2:85430284-85430306 TTGAAGCACTGGAGGGCGGGTGG + Intronic
933980166 2:87542874-87542896 CAGCTGCCCTGGGGGCAGGGAGG + Intergenic
934768909 2:96895646-96895668 CAGCAGCCCTGGGGGCAGGGCGG + Intronic
935203788 2:100880844-100880866 CAGGAGCACAGCAGGGAGGAGGG + Intronic
935306844 2:101745329-101745351 CAGCAGTATTGGGGGGGGGGGGG - Intronic
935341323 2:102062141-102062163 CAGCAGTTCTGGAGTGAGGGTGG - Intergenic
935634300 2:105238016-105238038 AGGCAGGAATGGAGGGAGGGAGG + Intergenic
935935505 2:108178035-108178057 CAGCAGCATTTGAGGGAGAAAGG + Intergenic
936039704 2:109140946-109140968 CAGCAGCCCCGGATGGAAGGTGG - Intronic
936048100 2:109202244-109202266 AGGCAGCACTGGAGGCAAGGTGG - Intronic
936313661 2:111407917-111407939 CAGCTGCCCTGGGGGCAGGGAGG - Intergenic
937104338 2:119295842-119295864 CAGCAGCACGGAATGGAGGAGGG + Intergenic
937505658 2:122533753-122533775 CAGCATCACTGGAGGCAGAGTGG + Intergenic
937521079 2:122712665-122712687 CAGCAGCACTCAAGGGGGAGAGG + Intergenic
937920105 2:127122730-127122752 GAGGAGAGCTGGAGGGAGGGGGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938150575 2:128879255-128879277 CAGCAGCTCAGAAAGGAGGGAGG - Intergenic
938235935 2:129707576-129707598 GAGCAGCACTGGGGGGTGGGGGG - Intergenic
938236297 2:129709486-129709508 CAGCTGCTCTGGGGGGATGGGGG - Intergenic
938421922 2:131153280-131153302 CAGCACCACAGGAGGGGAGGAGG - Intronic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
940089197 2:149897048-149897070 CAGCAGCACAGGAGGGACTGTGG - Intergenic
940089412 2:149898993-149899015 CAGCAGCACAGGAGGGACTGTGG - Intergenic
940506525 2:154561217-154561239 CTTCTGCACAGGAGGGAGGGCGG - Intergenic
940854736 2:158721165-158721187 CAGAAGCACTTGGGGGAGGGTGG - Intergenic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
941508415 2:166376069-166376091 CCGCAGGAGTGGAGAGAGGGAGG - Intergenic
941753757 2:169162830-169162852 CAGCAGCACAGGAGACACGGAGG - Intronic
941767643 2:169315751-169315773 CCACAGAACTGGAGGCAGGGAGG + Intronic
942008525 2:171734559-171734581 CAGTAACACTGGAGGGATGTTGG - Intronic
942147694 2:173042743-173042765 CAGCACCACAGGGAGGAGGGGGG - Intronic
942452169 2:176115072-176115094 CTGCAGCAAGAGAGGGAGGGAGG + Intronic
942512513 2:176717540-176717562 CAGCAGGACTGGGCAGAGGGAGG + Intergenic
942791821 2:179769491-179769513 CAGCAGCACAGGTAGGAGGCAGG - Exonic
943081796 2:183265281-183265303 CAGCTGCTCGGGAGGGAGGCTGG + Intergenic
943432923 2:187826584-187826606 CAGCTGCATTTGAGGGAGAGGGG - Intergenic
943769714 2:191703478-191703500 CAGCAGCGCTGGAGGCAGAAAGG + Intergenic
943772497 2:191733481-191733503 CAGAACCAGTGGAAGGAGGGTGG + Intergenic
943872777 2:193023112-193023134 CAACCACACTGGAGGGAGTGGGG - Intergenic
944534370 2:200695100-200695122 CAGGAGCAAGGGAGGGAGGAGGG - Intergenic
946752450 2:222906110-222906132 CAGCAGCCCTGGAAGAGGGGAGG - Intronic
948309224 2:236972534-236972556 CAGCAGCCCTGGAGGGTGCAAGG + Intergenic
948335665 2:237205073-237205095 CACCAAAAGTGGAGGGAGGGAGG + Intergenic
948456927 2:238108935-238108957 CAGCAGCGCTGCCGGGAGGGGGG - Intronic
948458214 2:238117052-238117074 CAGCTGCCCTGGAGGCATGGGGG + Intronic
948931946 2:241137535-241137557 CAGCAGGGAGGGAGGGAGGGAGG + Intronic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1169257236 20:4108885-4108907 CAGCAACACTGGAGGCCGGAAGG - Intergenic
1169354389 20:4895270-4895292 CAGCAGCACTGCCGGAAGGATGG - Intronic
1170606439 20:17878360-17878382 CAGCAGCCGTGGAGGCAGGCGGG + Intergenic
1171187460 20:23133061-23133083 CAGCAGCACTGAGGGGACTGGGG + Intergenic
1171965778 20:31529356-31529378 CAGCTACTCTGGAGGCAGGGTGG - Intronic
1172441139 20:34967558-34967580 AAGCAGCAGTGGAGGGCGGGGGG - Intergenic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1172916930 20:38450321-38450343 CAGCATCCCTGGAGTGAGGAGGG - Intergenic
1173169677 20:40713812-40713834 CAGAAGCACTGGGGGTGGGGAGG - Intergenic
1173425216 20:42936688-42936710 CAGCAGCACAGGAGGTGGGTAGG + Intronic
1173462467 20:43254292-43254314 AGGCAGCACTGGAGGCAGGGAGG - Intergenic
1173866221 20:46314121-46314143 CAGCAGCCCTGGGGAGAGGCAGG - Intergenic
1174169056 20:48604904-48604926 AAGAAACAGTGGAGGGAGGGAGG - Intergenic
1174295834 20:49544379-49544401 CAACAGCACTGCATGGAGGTTGG + Exonic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174898678 20:54476071-54476093 CAGCATCCCTGGAGGGTGGACGG + Intronic
1175257768 20:57657332-57657354 CCCCAGCACTTGAGGGAGGACGG + Intronic
1175258885 20:57662805-57662827 CATCAGCCCTGGAGGGAGGGAGG + Intronic
1175296133 20:57910004-57910026 CACCAGCACTGCAATGAGGGAGG - Intergenic
1175597127 20:60244200-60244222 CAGGTGCACTGGATGGAGGATGG + Intergenic
1175733575 20:61370452-61370474 CAGCGGCACTGGGGAGAGGGAGG - Intronic
1176087255 20:63303808-63303830 CTGCACACCTGGAGGGAGGGAGG - Intronic
1176673921 21:9759203-9759225 CAGGAGCACCGGAGGGAGCCTGG - Intergenic
1178945953 21:36947806-36947828 CAGCAGCTCTGCAGTGAGTGGGG + Exonic
1179343094 21:40531237-40531259 CAGCAGCCTTGGGGAGAGGGAGG - Intronic
1180072804 21:45445121-45445143 GGCCAGGACTGGAGGGAGGGAGG - Intronic
1180133533 21:45844445-45844467 CAACAATGCTGGAGGGAGGGTGG - Intronic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1180581903 22:16845904-16845926 CAGCACCCCTGGAAGGTGGGCGG - Intergenic
1181441221 22:22936030-22936052 CAGCAGGACCCCAGGGAGGGGGG + Intergenic
1182345696 22:29662827-29662849 CAGGGGCACTGGGGAGAGGGAGG + Intronic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1183403484 22:37618431-37618453 CAGCACCTGTGCAGGGAGGGGGG - Exonic
1183585852 22:38752550-38752572 CAGCAGCAGCGGAGGGAGCTCGG - Exonic
1183696651 22:39427499-39427521 GAGCAGCACTGGGGGGAGCACGG - Intronic
1184092896 22:42301668-42301690 GAGCAGCAAGGGAGGGAAGGTGG + Intronic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1184678198 22:46054568-46054590 CAGCAGGGGTGGAGGGTGGGAGG + Intronic
1184679393 22:46062004-46062026 CAGCGGCTCTGAAGGCAGGGAGG - Intronic
1184739774 22:46421185-46421207 CAGCACCTCGGCAGGGAGGGTGG - Intronic
1185034020 22:48461425-48461447 CAGCTACTCTGGAGGGAGGCAGG - Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185133245 22:49052434-49052456 CAGCACCACGGGAGGGAGGGCGG + Intergenic
949526296 3:4907891-4907913 CAGCAACCCTGAAGGGAGGCAGG + Intergenic
949534375 3:4984408-4984430 GAGCTGCCCCGGAGGGAGGGAGG + Exonic
949927757 3:9055548-9055570 CAGCTGCAGGGGAGGGAGGCTGG + Intronic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
949953604 3:9249533-9249555 CAGAGGCACCGAAGGGAGGGAGG - Intronic
950099401 3:10347801-10347823 CCCCAGGACTGGAGGCAGGGAGG - Intronic
950583467 3:13878125-13878147 CAGCTGCCCGGCAGGGAGGGAGG - Intronic
950733080 3:14979726-14979748 TGGCAGCAGTGCAGGGAGGGAGG + Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
952629249 3:35444776-35444798 CTGCAGCTCTGGAGGTAGGTTGG + Intergenic
953384691 3:42499880-42499902 CTGAAGCACTGGGGGGAAGGGGG - Intronic
953391671 3:42537383-42537405 CAGCCACACTCCAGGGAGGGTGG - Exonic
953828167 3:46272158-46272180 CAGCTGCACTGGGGGTAGGGTGG + Intergenic
953876756 3:46671057-46671079 TAACAGGACTGGAGGGAGAGAGG + Exonic
954509778 3:51113532-51113554 CAGCAGCTCTGGAGTCAGGGTGG - Intronic
955103280 3:55872758-55872780 CAGCACCTCTGGAGGCAGAGGGG - Intronic
955335272 3:58080334-58080356 CACCATTACTGGAGGCAGGGAGG + Intronic
955779822 3:62472600-62472622 CAGCTGCTCTGGATGGAGAGGGG - Intronic
956685590 3:71824623-71824645 CAGGAACCCTGGAGGGAGGGAGG + Intergenic
956929652 3:74028603-74028625 CAGCATCCCTAGAGGGAAGGTGG + Intergenic
956979010 3:74614725-74614747 CGGGCGGACTGGAGGGAGGGAGG + Intergenic
957956737 3:87197128-87197150 ATCCAGCAATGGAGGGAGGGTGG - Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958542435 3:95496165-95496187 CAGCAGGAGAGGAGGGTGGGTGG - Intergenic
959988337 3:112601712-112601734 CAGCAGCAACGAAAGGAGGGAGG + Intergenic
960004454 3:112767628-112767650 TAGCCCCACAGGAGGGAGGGAGG - Intronic
960583948 3:119303580-119303602 CACCACTACTGGAGGGAGAGGGG + Intronic
960948407 3:122982691-122982713 CAGCAGACCTGGGGGGTGGGGGG - Intronic
961004214 3:123393785-123393807 CAGCAGCCGGGGCGGGAGGGAGG - Intronic
961292659 3:125860062-125860084 CAGCGGGACTGCAGGGAGTGGGG - Intergenic
961354524 3:126327610-126327632 CAGCAGCACAGGAGATGGGGAGG - Intergenic
961390654 3:126550655-126550677 CATGAGCACAGGAGGTAGGGAGG - Intronic
961683341 3:128613484-128613506 CAGCCTCAGTGGAGGGAGGGAGG - Intergenic
962003981 3:131329825-131329847 CAGCCGGAATGGAGGGAGTGAGG + Intronic
962537397 3:136342406-136342428 GAGCAGCACTGGAGCCTGGGAGG - Intronic
962746905 3:138403637-138403659 CAGCAGCACCTGAGGTGGGGGGG - Exonic
962973857 3:140429324-140429346 AAGCTGCACTGGAGGGACCGTGG + Intronic
963009863 3:140759111-140759133 AAGGGGCACCGGAGGGAGGGAGG - Intergenic
966916107 3:184584784-184584806 CAGCAGGATTGCAAGGAGGGAGG + Intronic
967035351 3:185645286-185645308 CAGAAGCCCTGGGGGGCGGGAGG + Exonic
967327614 3:188257910-188257932 TAGCAGCACTGGGTGGAAGGTGG - Intronic
967685054 3:192409040-192409062 CAGCAGCACTGCAAAGAGAGCGG + Exonic
967909389 3:194528547-194528569 CAGCTGCTCGGGAGGGAGGCAGG - Intergenic
967956829 3:194883817-194883839 CAGCAGCAGTGGAGGTGGGCAGG - Intergenic
968435120 4:581106-581128 CAGAAGCTCTGGTGGGAGGGAGG - Intergenic
968501357 4:951667-951689 ATGCAGGCCTGGAGGGAGGGAGG - Exonic
968659609 4:1793633-1793655 CAGCAGCCAGGGAGGGAAGGGGG + Intronic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
968939011 4:3628459-3628481 CAGCACCGTGGGAGGGAGGGAGG - Intergenic
968953927 4:3708647-3708669 CACCAGCACTGAAGGGATGGAGG + Intergenic
969094826 4:4724408-4724430 CAGCTGCTCTGGAGAGATGGAGG - Intergenic
969174045 4:5385603-5385625 CAGCAGCCCTGGGAGGAGTGTGG - Intronic
969392748 4:6901971-6901993 CAGCGGCTCTGGAGGGAGACAGG + Intergenic
969439961 4:7211212-7211234 CAGGAGAGCGGGAGGGAGGGAGG + Intronic
969478400 4:7434125-7434147 CAGGAGCTCTGCAGGAAGGGGGG - Exonic
969494632 4:7519648-7519670 CAGCAGCAATGAAGGGATGAGGG - Intronic
969798036 4:9541155-9541177 GTGCAGCACTGGAGGGGGGCAGG + Intergenic
970116899 4:12707503-12707525 CGGCAACACTGAAGGGAGAGAGG + Intergenic
970488198 4:16545217-16545239 CAGAAGGAAGGGAGGGAGGGGGG - Intronic
970601137 4:17641978-17642000 CAGCCGCAGTAGGGGGAGGGGGG + Intronic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
972345774 4:38191125-38191147 CAGGACAACTGGAGGGAGAGAGG - Intergenic
973982221 4:56316118-56316140 CAGCAGCACCGGAGACAGCGCGG + Exonic
975650985 4:76592819-76592841 CAGCAGGATTCGAGGTAGGGAGG + Intronic
976141002 4:81991500-81991522 CAGCAGCAGTGGGGGTGGGGTGG + Intronic
976734582 4:88296800-88296822 CAGCTGCACTGGGGAGAGTGGGG + Intergenic
977616290 4:99090238-99090260 CAGCAGCAGTGGGGAGAGAGAGG - Intergenic
977798613 4:101198530-101198552 CAGGAGCACAGAAGGGAAGGAGG + Intronic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
980668217 4:135968080-135968102 TAGCTACACTGGAGGGAGGGAGG + Intergenic
981009975 4:139915681-139915703 AAGCAGCATTGGCGGGGGGGCGG + Intronic
981453188 4:144922461-144922483 CAGAAGCACTGGAGGATTGGAGG + Intergenic
981715053 4:147744541-147744563 AAGCAGGACTGGAGGTTGGGGGG + Intronic
982265322 4:153533372-153533394 CAGCAGCAGTGGCGGAGGGGAGG + Intronic
982771468 4:159400936-159400958 CAGCAGTTCTGCAGGGTGGGAGG - Intergenic
983080534 4:163380090-163380112 CAGCTGCTCGGGAGGGAGGCAGG + Intergenic
984373343 4:178894652-178894674 CAGCACCGGTGGAGGGAAGGAGG + Intergenic
984865265 4:184275417-184275439 CAGCAGAACAGCAGCGAGGGTGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985145845 4:186893792-186893814 CAGCAGCACTGGTGCACGGGTGG - Intergenic
985599099 5:816356-816378 CAGCTGCACGGGCGGGAGGGGGG + Intronic
985662612 5:1164821-1164843 CACCAGCGCTGGGGGGAGTGTGG + Intergenic
985676694 5:1235120-1235142 CAGGAGCACTGGACGGAGAGCGG - Intronic
985800455 5:2002399-2002421 CAGCAGCCCTGGAAGCAGGCAGG - Intergenic
986031112 5:3893311-3893333 AAGCAGGACAGCAGGGAGGGAGG - Intergenic
986731488 5:10637816-10637838 CAGCAGCGCTGCAGCCAGGGCGG + Intronic
986755410 5:10831586-10831608 CAGAAGCACTGGGTGGAGGGAGG - Intergenic
987026930 5:13936850-13936872 CAGCAGAAGTGGATGGAGGATGG + Intronic
987230829 5:15892031-15892053 CAGGAGCACTGGCAGGAGGCTGG - Intronic
987723840 5:21671753-21671775 AAGGAGGAATGGAGGGAGGGAGG - Intergenic
987945665 5:24605345-24605367 AATCAGCAGTAGAGGGAGGGGGG + Intronic
988487341 5:31677878-31677900 CAGCAGCAGAGGAGGAAGGGGGG + Intronic
989076583 5:37570058-37570080 AAGCAACACTAGAGGCAGGGAGG + Intronic
990047889 5:51457168-51457190 GAGGGGCAGTGGAGGGAGGGAGG - Intergenic
990289947 5:54339930-54339952 CAGCAGCACTGGAGAATGGCTGG - Intergenic
990317928 5:54601628-54601650 CAGCAGCACAGGAAAGTGGGGGG + Intergenic
990378052 5:55192913-55192935 CAGAAGCAGAGGTGGGAGGGTGG - Intergenic
990418971 5:55613498-55613520 CAGCAGCTGTGGAGGGTGTGTGG + Intergenic
990782959 5:59386684-59386706 CAGGAGGAAGGGAGGGAGGGAGG + Intronic
991379776 5:66007858-66007880 CAGCAGCTAAGGAGGGAGGTGGG + Intronic
991584439 5:68187720-68187742 GAGCAGCTCGGGAGGGAGCGCGG - Intergenic
992649184 5:78840764-78840786 CGGCAGCACTGCAGGGGTGGGGG + Intronic
992748242 5:79839468-79839490 AGGCAGCACTGAAGGGAGGGCGG + Intergenic
994176579 5:96718386-96718408 AAAGAACACTGGAGGGAGGGAGG + Intronic
996329532 5:122312811-122312833 GAACAGCACTAGAGGGAGGCTGG - Intronic
996552436 5:124744578-124744600 CAGCAGCACTGGCAAGAGGCAGG - Exonic
997046551 5:130325867-130325889 CAGCAGCAATGGAGGAAATGAGG + Intergenic
997076044 5:130678898-130678920 TAGCAGAAAGGGAGGGAGGGAGG + Intergenic
997583553 5:135031613-135031635 CAGGAACCCTAGAGGGAGGGAGG - Intronic
997604771 5:135166825-135166847 CAGCAGCAGTGGAGGGTGTGAGG + Intronic
997652402 5:135532185-135532207 GTGCAGCACTGGAAGCAGGGGGG - Intergenic
997748796 5:136324928-136324950 CTGCAGCCCTAAAGGGAGGGAGG - Intronic
998061213 5:139120116-139120138 CAGCAGCAGTGGGGGCAGTGAGG + Intronic
998150780 5:139756338-139756360 CCGCGGCGCTGGAGGGAGTGGGG + Intergenic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999737273 5:154522070-154522092 CAGCAGCACTGGAAGAGTGGGGG - Intergenic
1000097371 5:157983883-157983905 CAGAAGCACATGAGGGAGAGAGG + Intergenic
1000179500 5:158794250-158794272 CAGTGGCACTGGAGGGACAGAGG + Intronic
1001823072 5:174724880-174724902 CAGCAGCAGTGGCCGCAGGGTGG - Exonic
1001980474 5:176034514-176034536 AAGGAGCCCTGGAGGGTGGGTGG - Intronic
1002025934 5:176396297-176396319 CCACTTCACTGGAGGGAGGGAGG + Intronic
1002236987 5:177809551-177809573 AAGGAGCCCTGGAGGGTGGGTGG + Intergenic
1002325062 5:178399229-178399251 CCCCAGCACGTGAGGGAGGGAGG - Intronic
1002347930 5:178561066-178561088 CACCAGCCCTGCAGGGAGGGAGG + Intronic
1002364104 5:178696782-178696804 AAGCAGTACTGGGGAGAGGGTGG + Intergenic
1002420810 5:179148159-179148181 CAGCAGCACTGCAGCGCTGGCGG + Intronic
1002612787 5:180432313-180432335 CAGCAGCTGTGGAGGGTGCGTGG + Intergenic
1002681629 5:180969684-180969706 CAGCAGCTGTGGAGGGTGCGTGG - Intergenic
1002942843 6:1733255-1733277 CAGCAGCCCAGGGAGGAGGGCGG + Intronic
1003236046 6:4295901-4295923 CAGCAGGACTGGGGTGAGGCTGG - Intergenic
1003311309 6:4971999-4972021 CTGCAGGCCTGGAGGGAGTGGGG + Intergenic
1003438939 6:6121937-6121959 GAGGAGCACAGGAGGGAGGCTGG + Intergenic
1004159828 6:13203765-13203787 CAGCAGTTCAGGAGTGAGGGTGG + Intronic
1004475755 6:15969644-15969666 AAGCAGAACTGGAGTGAGTGGGG - Intergenic
1004897606 6:20163776-20163798 CAGCAGCCCTGGAGGTGAGGTGG + Intronic
1005480772 6:26253335-26253357 AGGCAGTTCTGGAGGGAGGGTGG + Intergenic
1005871036 6:29974689-29974711 CATCTGCACTGGAGGGGAGGGGG + Intergenic
1006054997 6:31377675-31377697 CAGCAGGCCTTGAGTGAGGGAGG - Intergenic
1006058885 6:31404765-31404787 CATCTGCACTGGAGGGGAGGGGG - Intronic
1006071369 6:31499650-31499672 CACCTGCACTGGAGGGGAGGGGG - Intronic
1006091930 6:31633421-31633443 CAGCAGAACTGCTGGGAGGTGGG - Exonic
1006172860 6:32105108-32105130 GAGCTGGAATGGAGGGAGGGAGG - Intronic
1006184908 6:32176030-32176052 CAGCAGAAAGGGAGGGAGGGAGG - Intronic
1006424927 6:33957975-33957997 CACCAGCAGGGGAGGAAGGGAGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006943509 6:37768606-37768628 GGGCAGCACTGCAGGGAGTGGGG + Intergenic
1007200938 6:40108686-40108708 GAGCAGCACTGGTAGGAGGCAGG + Intergenic
1007518406 6:42431584-42431606 AAGTAGAACTGGAGGAAGGGAGG + Intronic
1007631040 6:43273886-43273908 CTGCAGCCCTGGACAGAGGGTGG - Intronic
1007692318 6:43710555-43710577 GAGAAGAAATGGAGGGAGGGAGG + Intergenic
1007710105 6:43817461-43817483 CAGCAGCAGTGGAGAGGGGAGGG - Intergenic
1010985540 6:82419672-82419694 ACTCAGCAGTGGAGGGAGGGAGG - Intergenic
1012794956 6:103748400-103748422 CACCAGCACAGGCTGGAGGGTGG - Intergenic
1013414267 6:109910730-109910752 CAGCAGCCCTGGAGTGTGTGTGG + Intergenic
1013604985 6:111739215-111739237 CACCAGCAGTGCACGGAGGGTGG + Intronic
1014811695 6:125893913-125893935 AAGCTGCACTGGAGACAGGGAGG - Intronic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1016235417 6:141857915-141857937 CAGCTGCCCAGGATGGAGGGCGG + Intergenic
1016237697 6:141887857-141887879 CTGCTGCACTGGAGGGAATGAGG - Intergenic
1016722862 6:147323052-147323074 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1016990768 6:149926146-149926168 AAGAAGGATTGGAGGGAGGGCGG + Intergenic
1017050645 6:150390610-150390632 CAGCACCTATGGAGGGAGGAAGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017758655 6:157551215-157551237 CAGCACCCCAGGAGGAAGGGAGG - Intronic
1017758739 6:157551785-157551807 CACAGGCACTGCAGGGAGGGAGG - Intronic
1017882086 6:158569087-158569109 CAGCAGCTCTGGAGGCTGAGGGG - Intronic
1018861655 6:167714410-167714432 AAGCAGGAAGGGAGGGAGGGCGG + Intergenic
1018973601 6:168546595-168546617 TGGCAGCAGTGGAGAGAGGGAGG + Intronic
1019100764 6:169627485-169627507 CATCAGCACTAGAGGAAGAGAGG + Intronic
1019558195 7:1642794-1642816 CCGTAGCATGGGAGGGAGGGAGG - Intergenic
1019686824 7:2386583-2386605 CATCAGGAAGGGAGGGAGGGAGG + Intergenic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020079702 7:5280924-5280946 CAGCAGCAGAGGAAGGAGAGGGG + Intronic
1020110035 7:5442898-5442920 CAGCATGACTCGAGGGCGGGTGG - Intronic
1020150913 7:5680997-5681019 CAGCAGCATGAGAGGGAGTGAGG - Intronic
1020164342 7:5796414-5796436 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1021669468 7:23020799-23020821 CACAAGCACTGGATGAAGGGAGG + Intergenic
1021801827 7:24315004-24315026 CAGGGGCACTGGAGGCAGAGAGG + Intergenic
1022423566 7:30246469-30246491 CAGCAGCACCGGAGGAAAGCAGG + Intergenic
1022521894 7:31013804-31013826 GAGCAGCTTTGGAGGGAGTGGGG - Intergenic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1023575497 7:41622064-41622086 GAGAAGGAATGGAGGGAGGGAGG + Intergenic
1024007187 7:45233625-45233647 CATCAGGAATTGAGGGAGGGAGG - Intergenic
1024016909 7:45325520-45325542 CAGCAGGACTGGAAGGGGGAGGG + Intergenic
1024228772 7:47348053-47348075 GAAGAGCACTGGAGTGAGGGTGG - Intronic
1024672819 7:51612167-51612189 CAGCAGAGAGGGAGGGAGGGAGG + Intergenic
1025199202 7:56951279-56951301 CAGCAGCAGAGGAAGGAGAGGGG - Intergenic
1025672744 7:63625654-63625676 CAGCAGCAGAGGAAGGAGAGGGG + Intergenic
1025854025 7:65263046-65263068 CAGAAGCACTGGAGTTAGGCTGG - Intergenic
1026252166 7:68680352-68680374 CGGCAGGAAGGGAGGGAGGGAGG + Intergenic
1026972943 7:74479056-74479078 CAGCAGCAGGGGATGGAGGACGG - Intronic
1027414306 7:77958694-77958716 CAGCCTCTCTGGAGGGAAGGTGG + Intergenic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1028719416 7:94012081-94012103 CAGCAGCTGTGGAGGGTGTGTGG - Intergenic
1029177062 7:98672362-98672384 AGGTAGCACTGGAGGGATGGTGG - Intergenic
1029493012 7:100882428-100882450 CAGCAGGACAGGAGACAGGGCGG - Intronic
1029507148 7:100969302-100969324 GGGCAGCGCAGGAGGGAGGGAGG - Intergenic
1029904593 7:104078601-104078623 CAGCAGCACTTAGGGGAGAGAGG + Intergenic
1031080362 7:117251762-117251784 CAGCAGCTCAGCAGGGATGGGGG - Intergenic
1031541436 7:122999590-122999612 CAGCTGCACTAGGTGGAGGGAGG + Intergenic
1032069427 7:128794679-128794701 CAGGAGCCCTGCAGGGAGAGGGG - Exonic
1032423536 7:131802242-131802264 CAGCAGCCCTGGGGGGCTGGTGG - Intergenic
1032449556 7:132018121-132018143 CAGAAGTAAAGGAGGGAGGGAGG - Intergenic
1032716718 7:134515141-134515163 CAACAGCAGAGGATGGAGGGAGG - Intergenic
1033116483 7:138630397-138630419 CACCAGCACTGGCGCGGGGGTGG + Intronic
1033352587 7:140573690-140573712 CAGCAACACAGGTGGGAGAGGGG + Intronic
1033607861 7:142940589-142940611 CTGGAGCCCAGGAGGGAGGGAGG - Exonic
1033629040 7:143139296-143139318 CAGAAGGACAGAAGGGAGGGAGG + Intronic
1034162044 7:149001159-149001181 CAGGAGCAAGGGAGCGAGGGTGG - Intergenic
1034273857 7:149815664-149815686 GAGGGGCACAGGAGGGAGGGTGG - Intergenic
1034424666 7:151008199-151008221 CAGCAGCAGTGGAGATAGGAAGG + Intronic
1034439305 7:151078530-151078552 GAGATGCACTGGAGGGTGGGTGG + Intronic
1034512899 7:151550878-151550900 CAGCAGGACTTGAAGGAGGCAGG + Intergenic
1034590169 7:152131846-152131868 TAGCAGGGCTGGAGTGAGGGAGG + Intergenic
1035130638 7:156650182-156650204 CGGCAGCACCGGAAGGAGGCTGG - Intronic
1035194164 7:157201470-157201492 CAGCCACAGGGGAGGGAGGGCGG + Intronic
1035446945 7:158949574-158949596 CAGCAGCAAAGGTAGGAGGGAGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035767035 8:2114391-2114413 CAGCTGCACTGCAGGCAGGGAGG + Intronic
1036696025 8:10975684-10975706 CAGCAGCACTGGCAGGGGGCTGG + Intronic
1036700350 8:11009075-11009097 CAGCAGCTGTGTGGGGAGGGGGG + Intronic
1037709219 8:21342338-21342360 CATTAACACTGGAGGGATGGAGG + Intergenic
1037721860 8:21451014-21451036 CTGCAGCATTGGAGAGAGGGAGG - Intergenic
1037836162 8:22215990-22216012 CAGCAGCTCTGGTTGGCGGGAGG - Intergenic
1037915386 8:22769859-22769881 CTGCAGCAATGGCGGGAGGAAGG - Intronic
1038298387 8:26318217-26318239 CAGTAACACTGGAAGGAGGAAGG - Intronic
1038319447 8:26513996-26514018 CGGCAGCGCTGGGAGGAGGGAGG - Exonic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1038370586 8:26985906-26985928 CAGGAGCAAGGGAGAGAGGGAGG + Intergenic
1038865770 8:31437233-31437255 CAGCAGCAGAGGGGGGTGGGGGG + Intergenic
1040007515 8:42632773-42632795 CAGCTGGGCTGGAGGGAGTGAGG - Intergenic
1040594549 8:48824907-48824929 CAGCAGCACTGGGGAGAGAGAGG + Intergenic
1040915546 8:52564314-52564336 GGGCAGCGCTGGAGGGAGGAGGG - Intronic
1041143115 8:54843742-54843764 CTGCAGGACTGGAGCAAGGGTGG - Intergenic
1041215977 8:55600514-55600536 CAGCAGCTTTGCAGGGAGGTGGG - Intergenic
1041301319 8:56414839-56414861 CAGCAGATATTGAGGGAGGGAGG - Intergenic
1041312788 8:56533645-56533667 GGGCAGCAATGGAGGGATGGAGG + Intergenic
1042352066 8:67787449-67787471 CAGCCTCACTGGTGGAAGGGAGG + Intergenic
1042380146 8:68104172-68104194 CACCAGCAGTAGAGGTAGGGAGG - Intronic
1042480916 8:69301597-69301619 CACCATCTATGGAGGGAGGGAGG + Intergenic
1042942130 8:74118401-74118423 TTGCGCCACTGGAGGGAGGGAGG - Intergenic
1044798953 8:95933627-95933649 CAGCAGCCCAGCAGGGAGAGGGG - Intergenic
1045306828 8:100964824-100964846 AAGCAGCACAGGAAGGAGAGGGG + Intergenic
1045487103 8:102640346-102640368 AAGGAGAAATGGAGGGAGGGAGG + Intergenic
1045502673 8:102755521-102755543 CAGAACCACTGGCTGGAGGGTGG - Intergenic
1045691352 8:104763145-104763167 GAGAAGCACTGGGGGGTGGGAGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046048863 8:108996816-108996838 CAGTAGCACTGGAGAAATGGTGG - Intergenic
1047200370 8:122760217-122760239 CCTTAGAACTGGAGGGAGGGAGG + Intergenic
1048299396 8:133240098-133240120 CAGCAGCGTTGGAGGGAGCAAGG + Intronic
1049174456 8:141182976-141182998 AGGCAGCACTGCAGGGCGGGGGG + Intronic
1049212911 8:141394971-141394993 CAGCCTCCCTGGAGAGAGGGGGG + Intronic
1049228904 8:141472082-141472104 CAGAAGTGCTGGAAGGAGGGGGG - Intergenic
1049317711 8:141978118-141978140 GAACAGCACAGCAGGGAGGGTGG + Intergenic
1049403965 8:142443401-142443423 CTGCAGCACTGGAGGCAGGTGGG + Intergenic
1049542515 8:143214998-143215020 CAGCAGCACTGGGGACAAGGCGG - Intergenic
1049563836 8:143327097-143327119 CAGCACCACAGGACAGAGGGAGG - Intronic
1049594599 8:143477580-143477602 CACCAGGCCTGGAGGGAGGCAGG + Intronic
1049799059 8:144509401-144509423 CAGCAGCACTGGCAGGAGGCCGG - Exonic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050949490 9:11570122-11570144 CAGCAGCTCTTCTGGGAGGGTGG - Intergenic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1053024500 9:34718820-34718842 CACCAGCAGTGGGAGGAGGGTGG - Intergenic
1053035910 9:34826629-34826651 CACCAGCAGTGGGAGGAGGGTGG - Intergenic
1053273733 9:36767686-36767708 GAGAAGGAGTGGAGGGAGGGGGG + Intergenic
1053537283 9:38938186-38938208 CAGCACCAGTGGAAGGAGAGCGG - Intergenic
1054451735 9:65406861-65406883 CAGCACCGTGGGAGGGAGGGAGG + Intergenic
1054452499 9:65410683-65410705 CAGGACCACTGGAAGGAGGGAGG + Intergenic
1054628852 9:67425744-67425766 CAGCACCAGTGGAAGGAGAGCGG + Intergenic
1055224453 9:73977447-73977469 CAGAAGAACGGGAGGAAGGGAGG + Intergenic
1056802742 9:89704661-89704683 CACCAGCAGTGGATGGAGGTTGG - Intergenic
1057302294 9:93893958-93893980 CAGCAGAGCGGGAGGGAGGTGGG - Intergenic
1058049475 9:100392292-100392314 CACCAGAACTCGAGGCAGGGAGG - Intergenic
1058388043 9:104461532-104461554 CGGCAGGAAGGGAGGGAGGGAGG + Intergenic
1058767339 9:108194631-108194653 AGGCAGGACTGGAGGCAGGGAGG - Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059340681 9:113595840-113595862 CAGCAGCACAGGAAGGGGAGAGG + Intronic
1060474599 9:123977209-123977231 CAGAGGGACTGGAGGGAGTGAGG + Intergenic
1060476763 9:123992914-123992936 CAGAGGGACTGGAGGGAGTGAGG - Intergenic
1060556836 9:124512353-124512375 CAGCTGCAGTGTGGGGAGGGGGG + Intergenic
1060729859 9:126030503-126030525 CAGCAGGAAGGGAGAGAGGGTGG - Intergenic
1060798212 9:126526804-126526826 CAGCAGCTCTGGAAGGAATGGGG - Intergenic
1060805738 9:126575007-126575029 CAGCTTCACTGGGGGTAGGGAGG + Intergenic
1061014218 9:127972640-127972662 CTGCAGGCCTGGAGGCAGGGAGG + Intronic
1061102742 9:128504620-128504642 CAGGCGCACTGGTGGGAGGGCGG + Intergenic
1061187180 9:129061349-129061371 GAGCAGGTGTGGAGGGAGGGAGG + Intronic
1061246625 9:129404134-129404156 CTGCAGCAGTGGAGGGACAGAGG + Intergenic
1061259381 9:129471423-129471445 CAGGAGCCCTGAAGGGTGGGTGG + Intergenic
1061761613 9:132855577-132855599 AACCAGCACTGGGGGCAGGGTGG - Intronic
1062181440 9:135193243-135193265 CAGGAGCACTGAAGGGAGGGAGG - Intergenic
1062290681 9:135793053-135793075 CAGCAGCAAAGGACGCAGGGTGG - Exonic
1062362934 9:136196053-136196075 CATGAGCACTGGAAGGAGGTGGG - Intergenic
1062388545 9:136324914-136324936 CAGCAGCACAGGGCGCAGGGTGG - Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186171098 X:6877839-6877861 CAGCATTACTTGAGGGAGTGGGG - Intergenic
1186534216 X:10330124-10330146 CAGCAGAACTGAAGTGTGGGAGG - Intergenic
1187067525 X:15854946-15854968 CAGCGGCACCGGAGGCAGCGCGG + Intronic
1188833908 X:34933164-34933186 CAGCAGCAGTGGTGGCAGTGAGG - Intergenic
1188986786 X:36775226-36775248 CAGCAGCACTGCATGGGTGGAGG - Intergenic
1189364766 X:40380064-40380086 GGGCAGCACAGGAGGGAGGTGGG - Intergenic
1192399278 X:70818173-70818195 CAGCTACACAGGAGGGAGGTGGG + Intronic
1192600608 X:72459705-72459727 AAGCAGCTAGGGAGGGAGGGTGG - Intronic
1193636846 X:83961449-83961471 CAGCAGGAAGGGTGGGAGGGGGG + Intergenic
1193880412 X:86914138-86914160 CAGCAGGACTGGACAGAGAGAGG - Intergenic
1195062426 X:101209466-101209488 CAAAAGCAATGTAGGGAGGGTGG - Intergenic
1195908054 X:109864849-109864871 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1197254482 X:124247832-124247854 AAGCAGCAATGGAGGGATTGAGG - Intronic
1198449704 X:136754799-136754821 CAGGAGCACAGGAGGAGGGGTGG - Intronic
1199672920 X:150161745-150161767 AAGAAGCAATGGAGGGAGAGGGG - Intergenic
1200054767 X:153454503-153454525 CAGCAGCTGGGGAGGGAGGGAGG + Exonic
1200091454 X:153638015-153638037 CGGCACCAGTGGTGGGAGGGAGG + Intergenic
1200966159 Y:9040513-9040535 TCTCAGCACTGGAGAGAGGGAGG - Intergenic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201554221 Y:15251644-15251666 CAGAAACACTGGAGGCAGAGAGG + Intergenic
1202195592 Y:22296219-22296241 CAGCACTACTGGAGGGAGTTAGG + Intergenic