ID: 1145012547

View in Genome Browser
Species Human (GRCh38)
Location 17:19378132-19378154
Sequence CGGGCAGTTCCCCGAGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145012536_1145012547 19 Left 1145012536 17:19378090-19378112 CCAGTAGCCAAGGTAACAGTCCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG 0: 1
1: 0
2: 0
3: 10
4: 131
1145012537_1145012547 12 Left 1145012537 17:19378097-19378119 CCAAGGTAACAGTCCCAGACCTG 0: 1
1: 0
2: 1
3: 17
4: 301
Right 1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG 0: 1
1: 0
2: 0
3: 10
4: 131
1145012541_1145012547 -1 Left 1145012541 17:19378110-19378132 CCCAGACCTGGGCATCTCAGGCC 0: 1
1: 0
2: 0
3: 23
4: 261
Right 1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG 0: 1
1: 0
2: 0
3: 10
4: 131
1145012542_1145012547 -2 Left 1145012542 17:19378111-19378133 CCAGACCTGGGCATCTCAGGCCG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG 0: 1
1: 0
2: 0
3: 10
4: 131
1145012545_1145012547 -7 Left 1145012545 17:19378116-19378138 CCTGGGCATCTCAGGCCGGGCAG 0: 1
1: 0
2: 3
3: 18
4: 187
Right 1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145012547 Original CRISPR CGGGCAGTTCCCCGAGCTCA CGG Intronic
900148976 1:1170048-1170070 GGGGAAGGTCCCCGAGCTCCGGG - Intergenic
903138222 1:21322908-21322930 AGGGCAGGTCCCAGGGCTCAGGG + Intronic
911254505 1:95618650-95618672 TGGGCAGTTCACCCTGCTCAGGG + Intergenic
913229483 1:116729885-116729907 TGGGCTGTTCCCTGAGCCCATGG + Intergenic
916810769 1:168303738-168303760 CGGGCAATTCCCACAGCTGAGGG + Intronic
917071779 1:171159397-171159419 TGGGCAGTTCCCAGAACTGAGGG - Intronic
922815073 1:228443037-228443059 TGGGCAATTCCCAGAGCTGAGGG - Intergenic
1065218738 10:23474797-23474819 TGGGCAATTCCCAGAACTCAGGG + Intergenic
1067823294 10:49549786-49549808 TGGGCAGTTCCCAGAACTGAGGG + Intergenic
1073255555 10:102148741-102148763 CAGGCAGCTCTCTGAGCTCAAGG - Intronic
1073535671 10:104274878-104274900 TGCGCAGCTCCCGGAGCTCACGG - Exonic
1076691674 10:132226862-132226884 CGTGCAGTTCTCCGAGGACACGG - Exonic
1080077668 11:28170605-28170627 TGGGCAATTCCCAGAGCTGAGGG + Intronic
1084204703 11:67584690-67584712 CGGGCAGCTCCCCAAGTTCCAGG + Exonic
1084410480 11:69003612-69003634 CGGGCAGCACTCCGAGCTCCAGG - Intergenic
1085045827 11:73352901-73352923 CGACCAGATCCCCGAGCTCCTGG + Exonic
1085217174 11:74843244-74843266 CGGCCACTTCCTCGAGTTCATGG - Exonic
1092131666 12:6117396-6117418 CAGGCATTTCCACGAGGTCAGGG - Intronic
1097338596 12:58412548-58412570 TGGGCAATTCCCCGAACTGAAGG + Intergenic
1097995692 12:65885904-65885926 TGGGCAGTTCCCGGAACTAAGGG - Intronic
1100923889 12:99521969-99521991 CGGGAAGTTCCCCTAGGTCCTGG + Intronic
1104640517 12:130464054-130464076 TGGGCAGTTCCCGGAACTGAGGG - Intronic
1111253717 13:85639279-85639301 AGTGCAGTTTCCCGTGCTCAGGG + Intergenic
1113543924 13:111131670-111131692 CGGGCAGTGACCTGAGGTCAGGG + Intronic
1114616945 14:24073338-24073360 CAGGCAGCACCCCAAGCTCAGGG + Intronic
1119190930 14:72681229-72681251 CGGAGAGTCCCCCGAGCACAGGG + Intronic
1119234123 14:73005386-73005408 TGGCCAGTTGGCCGAGCTCAGGG - Intronic
1119804177 14:77471611-77471633 CGGGCAGATACCTGAGGTCAGGG + Intergenic
1120529011 14:85609716-85609738 GGGGCTGCTCCCCCAGCTCATGG - Intronic
1123091744 14:105745081-105745103 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091768 14:105745160-105745182 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091813 14:105745318-105745340 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091836 14:105745397-105745419 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091874 14:105745544-105745566 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123097442 14:105773196-105773218 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123097513 14:105773508-105773530 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123097639 14:105773979-105774001 GCGGCAGCTCCCGGAGCTCAGGG - Intergenic
1123097658 14:105774058-105774080 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123097721 14:105774312-105774334 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1126624216 15:50670609-50670631 TGGGCAGTTCCCAGAACTGAGGG - Intronic
1127212171 15:56784549-56784571 TGGGCAGTTCCCAGATCTGAGGG - Intronic
1130512524 15:84601173-84601195 CGGGCAGTAGCCCGAGGTGAGGG + Exonic
1131562387 15:93455806-93455828 GGGGCAGTTCCTGGAGCTCAGGG - Intergenic
1132657729 16:1048379-1048401 AGGGCAGATCCCTGAGCTCAGGG + Intergenic
1133843778 16:9435570-9435592 GGGGCAGCTCCTGGAGCTCAGGG + Intergenic
1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG + Intronic
1134849782 16:17470583-17470605 CGGGCAGGTCCCGGCGCTCCCGG + Exonic
1135097839 16:19579286-19579308 TGTGCAGTTGGCCGAGCTCACGG + Intronic
1135976304 16:27110718-27110740 AGGTCAGCTCCCGGAGCTCATGG - Intergenic
1137695392 16:50458422-50458444 CGGGCAATTCCCTGAACTAAGGG - Intergenic
1142102928 16:88285186-88285208 GGGGCAGTTCTCCGGGCACACGG - Intergenic
1144735240 17:17551973-17551995 CGGGCAGATCACCTAGGTCAGGG + Intronic
1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG + Intronic
1150373398 17:64661507-64661529 GGGGCTGTTCCCCGAGCCCCGGG + Intronic
1150447195 17:65235715-65235737 TGGGCAGTTCCCGGAACTGAGGG - Intergenic
1150778820 17:68102260-68102282 GGGGCTGTTCCCCGAGCCCCGGG - Intergenic
1151370232 17:73643115-73643137 CGGGCAGGTCCCCGAGGTGAAGG - Intronic
1153263814 18:3248137-3248159 CCGGCAGTCGCCCAAGCTCAAGG - Intronic
1153608446 18:6857494-6857516 CGTGCAGTTCCCTGACCACATGG - Intronic
1154216613 18:12420672-12420694 GGGGAACTTCCCCGAGATCAGGG + Intronic
1154269108 18:12904133-12904155 CGGGCAGTTCCCGGAACTGAGGG - Intronic
1160738764 19:676500-676522 CGCGGGGTTCCCCGAGCCCATGG - Exonic
1161243755 19:3237465-3237487 TGGGCAGTTCCTGGAGCTGAAGG + Intronic
1161248054 19:3265639-3265661 TGGGCAGTTCCTGGAGCTGAAGG - Intronic
1163678660 19:18668411-18668433 CCGCCACTTCCGCGAGCTCACGG + Exonic
1164323457 19:24171227-24171249 CGGTGGGTTCCCAGAGCTCAGGG - Intergenic
1165243163 19:34482657-34482679 CCGGCAGTTCCCTGCGCGCATGG + Intronic
1165824418 19:38697726-38697748 AGGGCTGTTCCCCGAGGGCAAGG - Intronic
925450834 2:3968188-3968210 CAGGCAGTGCTCCCAGCTCAGGG + Intergenic
929232335 2:39572632-39572654 TGGGCAGTTCCCAGAACTGAGGG + Intergenic
933691330 2:85181552-85181574 CAGGCAGCTCCCAGAGCCCAGGG + Intronic
935271108 2:101435168-101435190 CAGGCAGCCCCCTGAGCTCATGG + Intronic
937537305 2:122906071-122906093 TGGGCAATTCCCAGAGCTGAGGG + Intergenic
937909815 2:127069994-127070016 GGGCCAGTTCCCCGACATCAAGG - Exonic
942018548 2:171842677-171842699 CTGGAAGTTGCCAGAGCTCAGGG + Intronic
943033770 2:182716072-182716094 AGGGCAGTTCCCTCAGCTCCGGG + Intronic
944413580 2:199463507-199463529 CGGGCAGTGACCCGGGCTCGAGG - Intronic
945192209 2:207200440-207200462 CGGGTACTTTCCTGAGCTCAGGG + Intergenic
945252135 2:207772655-207772677 CGGGCAATTCCCGGAACTGAGGG - Intergenic
948846843 2:240687437-240687459 CTGGCAGTACCCCCAGCTGATGG + Intergenic
1171350112 20:24495437-24495459 CATCCAGTTCCCCGAGCTGACGG + Intronic
1172094358 20:32453375-32453397 CCGGCAGTTCCCTGAGTTCCAGG - Exonic
1175119390 20:56706655-56706677 CGTGCTTATCCCCGAGCTCATGG + Intergenic
1175387747 20:58608205-58608227 TTTGCAGTTCCCCCAGCTCAGGG - Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1178708064 21:34890239-34890261 CGCGCAGTCCCCGGAGCTCCCGG + Intronic
1179171518 21:38976646-38976668 TGGGCATTTTCCCCAGCTCAGGG + Intergenic
1180891421 22:19291729-19291751 GGCGCAGTGCCCCGAGCTCCCGG + Intergenic
1181953052 22:26568688-26568710 TGGGCAGTTCCCAGAACTGAGGG - Intronic
1182454654 22:30442432-30442454 TGGGCAGTTCCCCTAACTGACGG + Intergenic
1183831905 22:40422723-40422745 CGGGCAGCTCCCAGAGCTAGTGG + Intronic
1184059612 22:42074119-42074141 CGGGCAGTTCACCGCCCTCTCGG + Intergenic
953140331 3:40223789-40223811 AGGTAAGTTCCACGAGCTCAGGG - Intronic
955677046 3:61459713-61459735 CAGTCAGTTCCCTGAGGTCATGG - Intergenic
956117241 3:65930877-65930899 CGGGCAATTCCCAGAGCTGAGGG - Intronic
957210391 3:77251051-77251073 CCTGCAGTTCCAGGAGCTCAGGG + Intronic
958038374 3:88196039-88196061 TGGGCAGTTCCCAGAACTGAGGG + Intergenic
961839773 3:129699430-129699452 TGGGCAATTCCCTGAACTCAAGG - Intronic
968187372 3:196642542-196642564 CGGGCAGTTGCTAGAACTCATGG - Intronic
976221391 4:82759314-82759336 TGGGCAGTTCCCCAAGGGCAGGG + Intronic
976663693 4:87567137-87567159 CAGGCTGTTTCCTGAGCTCATGG + Intergenic
979725341 4:123954379-123954401 TGGGCAGTTCCCAGAACTGAGGG + Intergenic
981410629 4:144426176-144426198 CAGGCAATTGCCTGAGCTCAGGG + Intergenic
982644771 4:158009652-158009674 TGGGCAATTCCCCGAACTGATGG + Intergenic
985478269 5:91921-91943 ATGGCAGGTCCCCGAGCTCCGGG + Intergenic
986458012 5:7940016-7940038 CAGTGAGTTCCCAGAGCTCAGGG + Intergenic
986918278 5:12652530-12652552 CAGACAATTCCCAGAGCTCATGG + Intergenic
988848649 5:35156611-35156633 CGGGCAGGTTCCTGAGGTCAGGG + Intronic
989003827 5:36788076-36788098 CAGGAAGTTCCCCGAGCCCCTGG - Intergenic
989445880 5:41527709-41527731 TGGGCAGTTCCCAGAACTGAGGG - Intergenic
998384628 5:141749665-141749687 CAGTCAGTTCCCAGAGCACATGG + Intergenic
1001355099 5:171013173-171013195 AGAGCAGTTCCCAGAACTCAAGG + Intronic
1005331649 6:24756432-24756454 TGGGCAGTTCCCAGAGCTGAGGG + Intergenic
1018484587 6:164228094-164228116 AGGGCAGGTGCCCGTGCTCAGGG - Intergenic
1018861427 6:167713117-167713139 CAGGCAGTCCCCCAGGCTCAGGG + Intergenic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1019665924 7:2252367-2252389 CGGGCAGGTCCCCAGGCTCAGGG - Exonic
1020114789 7:5470387-5470409 CGGGCAGCTGCCCCAGCTCCTGG + Intronic
1022520255 7:31001663-31001685 AGGGCAGTTCACAAAGCTCAAGG + Intergenic
1025901960 7:65751622-65751644 CGGGCTTTTCCCCGATCTTAGGG - Intergenic
1027951413 7:84821770-84821792 TGGGCAGTTCCCAGAACTGAGGG + Intergenic
1028622259 7:92836878-92836900 CCGGCAGTGCTCCGAGCTCCGGG + Intergenic
1032514178 7:132494842-132494864 CCAGCAGTTCCCCAGGCTCAGGG + Intronic
1032643261 7:133793393-133793415 CGGGCAGTTCACAGACCCCACGG + Intronic
1033095041 7:138423405-138423427 CGAGCAGTTCACAGAACTCAGGG - Intergenic
1033734137 7:144205480-144205502 CAGGCAGTTCCCAGAACTGAGGG + Intergenic
1033748914 7:144345493-144345515 CAGGCAGTTCCCAGAACTGAGGG - Intergenic
1042455912 8:69002397-69002419 TGGGCAGTTCCCAGAACTGAAGG - Intergenic
1045253166 8:100498038-100498060 TGGGCAATTCCCAGAGCTGAGGG + Intergenic
1045452201 8:102338559-102338581 CGGGCAGTTCCTGCAGGTCATGG - Intronic
1051363494 9:16303231-16303253 TGGGCAATTCCCAGAGCTGAGGG - Intergenic
1057665045 9:97038683-97038705 CAGGCAGCTCCCGGAGCTCCGGG + Intronic
1057780027 9:98041908-98041930 CGGGCAGATCACTGAGGTCAGGG - Intergenic
1060209281 9:121700040-121700062 CAGGCTGTGCCCCCAGCTCAGGG - Intronic
1060980643 9:127789659-127789681 CGGGCTGCTCCCAGAGCCCAGGG - Exonic
1061538658 9:131265611-131265633 CGGGCAGTCACCTGAGGTCAGGG - Intronic
1061885465 9:133589115-133589137 CGGGCAGGAGCCCCAGCTCACGG - Intergenic
1062533034 9:137010045-137010067 CGCGCTGTTCGACGAGCTCACGG - Exonic
1190010117 X:46777107-46777129 TGGGCAATTCCCAGAGCTGAGGG - Intergenic
1195230426 X:102841558-102841580 TGGGCAGTTCCCAGAACTGAAGG + Intergenic
1197569043 X:128127058-128127080 CGGGTTGTTCCCTGAGCTCAAGG + Intergenic
1200090203 X:153632468-153632490 CGGGCAGTCACCCGAGCACCTGG + Intergenic