ID: 1145012886

View in Genome Browser
Species Human (GRCh38)
Location 17:19379581-19379603
Sequence TCACAACTCCCCTGCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145012886_1145012893 18 Left 1145012886 17:19379581-19379603 CCTGCCCCGCAGGGGAGTTGTGA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1145012893 17:19379622-19379644 TAGGTAACATGCTTAGCACAGGG 0: 1
1: 0
2: 5
3: 42
4: 282
1145012886_1145012891 -1 Left 1145012886 17:19379581-19379603 CCTGCCCCGCAGGGGAGTTGTGA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1145012891 17:19379603-19379625 AAGGTAACATTTAATAATGTAGG 0: 1
1: 0
2: 2
3: 33
4: 361
1145012886_1145012892 17 Left 1145012886 17:19379581-19379603 CCTGCCCCGCAGGGGAGTTGTGA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1145012892 17:19379621-19379643 GTAGGTAACATGCTTAGCACAGG 0: 1
1: 0
2: 5
3: 29
4: 161
1145012886_1145012894 23 Left 1145012886 17:19379581-19379603 CCTGCCCCGCAGGGGAGTTGTGA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1145012894 17:19379627-19379649 AACATGCTTAGCACAGGGCTTGG 0: 1
1: 3
2: 24
3: 155
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145012886 Original CRISPR TCACAACTCCCCTGCGGGGC AGG (reversed) Intronic
901014961 1:6223671-6223693 TCACAACACCCCTGTGAGGTAGG + Exonic
901231493 1:7644069-7644091 TGACAACTCCGCTGGCGGGCAGG - Intronic
901954958 1:12777381-12777403 TCATAACTCTCCAGAGGGGCAGG - Exonic
901960797 1:12825111-12825133 CCATAACTTTCCTGCGGGGCAGG + Exonic
901972675 1:12920222-12920244 TCATAACTCTCCAGAGGGGCAGG - Exonic
901975190 1:12938844-12938866 TCATAACTCTCCCGGGGGGCAGG + Exonic
901982792 1:13049977-13049999 CCATAACTCTCCCGCGGGGCAGG + Intronic
901999297 1:13178941-13178963 CCATAACTCTCCCGCGGGGCAGG - Intergenic
902009985 1:13262920-13262942 TCATAACTCTCCCGGGGGGCAGG - Exonic
902012505 1:13281540-13281562 TCATAACTCTCCAGAGGGGCAGG + Exonic
902030848 1:13421067-13421089 TCATAACTCTCCCGCGGGGCAGG - Exonic
902995349 1:20220803-20220825 TCACAACTGCCCTGCTAGGGAGG + Intergenic
903353927 1:22734982-22735004 TCAGAACACCCCTGCAGGGTAGG + Intronic
903671890 1:25040912-25040934 TCACAACACCCCTGGGAGGTGGG + Intergenic
904081074 1:27872864-27872886 TCATCACTACCCTGCGGGGCAGG - Intronic
904196691 1:28790976-28790998 TCACAACAGCCCTGGGGTGCAGG - Intergenic
904415583 1:30359303-30359325 TCACAACCACCCTGTGGGGAAGG + Intergenic
905123251 1:35698855-35698877 TCACAACTTCCCTGTGAGGTAGG + Intergenic
905913730 1:41671126-41671148 TCACAAGTCCCCTGAGAGGGAGG - Intronic
906161290 1:43650725-43650747 TCACAGCGACCCTGCAGGGCAGG + Intronic
906399019 1:45491178-45491200 CCCCAACCCCCCTGCTGGGCCGG - Intergenic
907313121 1:53551326-53551348 TCACAACAACCCTGAGAGGCAGG - Intronic
907484372 1:54766939-54766961 TCACAACCCCCTTGGGAGGCAGG + Intergenic
917034914 1:170737808-170737830 TCACAACACCCCTGTGAGGTAGG - Exonic
917554310 1:176067925-176067947 TCACAACTCCTCTGAGCAGCAGG + Intronic
918781696 1:188708098-188708120 TCCCAACTCCCCTGCTGGGGAGG + Intergenic
919315715 1:195968735-195968757 TCAAAACTGCACTGAGGGGCTGG + Intergenic
920279840 1:204834535-204834557 TCACTCCTCCCCTCCCGGGCTGG + Intronic
922091675 1:222401261-222401283 TCACAACTCCATTGGGGGGGTGG - Intergenic
922800363 1:228362205-228362227 TCACAACCCCCCACCAGGGCTGG - Intronic
1063722677 10:8599915-8599937 TCACAGTTCCACTGCGAGGCTGG + Intergenic
1064381584 10:14846659-14846681 TCACAACACCCCTGTGAGGTAGG - Intronic
1067473908 10:46554086-46554108 TCACAACAACCCTGCAGGGTGGG - Intronic
1069604467 10:69730950-69730972 TGACAACAACCCTGTGGGGCAGG + Intergenic
1069724468 10:70568362-70568384 TCACAACACCCCTGTGAGGTAGG - Exonic
1070386323 10:75927942-75927964 TCACAACAACCCTGTGAGGCAGG - Intronic
1070489929 10:76966775-76966797 TCACACCTCCTCTGCGGGTGTGG + Intronic
1071568495 10:86683881-86683903 GCACAACCCACCTGCGGGGTAGG + Intronic
1072524410 10:96258812-96258834 TCACAACTACCCTGTGAGGGAGG + Intronic
1073057922 10:100713991-100714013 TCCCACCTCCGCTGCGGGCCAGG - Intergenic
1073133386 10:101205325-101205347 TCACCACTCCCCTGGGGGTAGGG + Intergenic
1073165959 10:101451834-101451856 TCACAAAGCCCCTGAGCGGCAGG - Intronic
1073267795 10:102238696-102238718 GCACAACTGCCCTGCATGGCTGG + Intronic
1075003571 10:118815056-118815078 TCAGAACTCCCCTGCAGGGTAGG + Intergenic
1075320288 10:121485941-121485963 TCACAGCTGCCCTGTGTGGCTGG + Intronic
1075789774 10:125075808-125075830 ACACAACTCCCATGCGCAGCTGG + Intronic
1075818437 10:125284513-125284535 TCACAAGTCCCCAGAGGAGCAGG - Intergenic
1077074340 11:693722-693744 TCACAGATGCCCTACGGGGCTGG - Intronic
1079098962 11:17528890-17528912 TCACAACAACCCTGCAGAGCAGG + Intronic
1081700311 11:45148335-45148357 TCACAACTTCCTTGCCGGGCAGG - Intronic
1082799270 11:57402398-57402420 TCATCAATCCCCTGAGGGGCTGG + Intronic
1083455500 11:62776134-62776156 TCACAACAGCCCTGTTGGGCAGG + Intronic
1083755717 11:64790573-64790595 TCACAACAGCCCTGTGGGGCTGG + Intronic
1083769003 11:64856049-64856071 TCACCACAGCCCTGCGGGGTGGG + Intronic
1083871738 11:65492544-65492566 TCACAACAGCCCTGTGGGGGAGG - Intergenic
1085053859 11:73393011-73393033 CCACTACTCCCCTGCAGGGCAGG + Intronic
1086065080 11:82735070-82735092 TCACAAGTGCCCTGTGGGGAGGG - Intergenic
1087013444 11:93534505-93534527 TCACAACAACCCTGTGAGGCAGG + Intronic
1088556374 11:111065455-111065477 TCACAACAACCCTGCATGGCAGG - Intergenic
1089510610 11:118994543-118994565 TCAAAACTCCCAAGCTGGGCTGG + Intergenic
1089973105 11:122710430-122710452 TCACAACCACCCTGCAAGGCAGG + Intronic
1090279875 11:125446415-125446437 TCTCAACAACCCTGCGGGGTAGG - Intronic
1090384407 11:126348227-126348249 TCTCGACTCCCCCGAGGGGCTGG + Intergenic
1092150738 12:6246625-6246647 TCAAAACTACCATGTGGGGCTGG - Intergenic
1092945688 12:13451655-13451677 TCAAGACGCCCCTGGGGGGCTGG - Intergenic
1094029264 12:25992423-25992445 TCACAACAACCCTGTGAGGCAGG - Intronic
1095441474 12:42242427-42242449 TCAAAACTCCCGTGCAGCGCTGG + Intronic
1096105531 12:48995233-48995255 TCACAACAACCCTGCGAGGTAGG + Exonic
1096459131 12:51812400-51812422 TCACAACACCCCTGTGAGGTAGG - Exonic
1096477741 12:51918713-51918735 TCACAACAGCCCTGTGGGGTGGG - Intronic
1096982209 12:55734814-55734836 TCACAACTGCCCTGTGAGGTGGG - Intergenic
1100458679 12:94777200-94777222 TCACCACTACCCTGAGGGGCAGG + Intergenic
1100878610 12:98991652-98991674 TCACAACTACCCTACGAAGCAGG + Intronic
1101940612 12:109097162-109097184 CCACAACACCCCTAAGGGGCAGG + Intergenic
1102036057 12:109771110-109771132 TCACAACACCCTTGCAGGGTGGG + Intergenic
1103394879 12:120599818-120599840 CCTCAACTACCCTGCGGGGCAGG + Intergenic
1115555432 14:34541651-34541673 TCACAACACCCCTGTGAGGTAGG - Intergenic
1115558476 14:34561442-34561464 TCACAACACCCCTGTGAGGTAGG + Intronic
1116707933 14:48327013-48327035 TCACAACTGACCTTCTGGGCTGG + Intergenic
1120755598 14:88241365-88241387 TCACAACAACCCTGTGGGGAAGG - Intronic
1121791799 14:96704591-96704613 TCACCACTGCCCTGTGGGGAGGG - Intergenic
1122321121 14:100856474-100856496 TCACAACAGCCCTGCGAGGTAGG - Intergenic
1122628919 14:103098650-103098672 TCACAACACCCCTGCCCTGCTGG + Intergenic
1122809495 14:104281032-104281054 TCAGCTCTGCCCTGCGGGGCAGG - Intergenic
1124363082 15:29053237-29053259 ACACAAGTCCCCAGCGTGGCAGG - Intronic
1124553843 15:30707990-30708012 TCACAACAACCCTGCGCTGCAGG - Intronic
1124694497 15:31852713-31852735 TCACAGCTACCCTGCCAGGCAGG - Intronic
1124702961 15:31932988-31933010 TGACAACTCCTCTGCAGAGCGGG - Intergenic
1124997519 15:34737927-34737949 TCACAACTCCCCTGTGAGCTAGG - Intergenic
1125538276 15:40455290-40455312 CCACTACTCCCCTGGGGGGTAGG - Intronic
1126663824 15:51057462-51057484 TCACAACAGCCCTGTGAGGCAGG + Exonic
1128554601 15:68622805-68622827 TCACAACACCCCTGTGAGGCAGG + Intronic
1128609342 15:69061442-69061464 TCTCAACTCCCAGGCTGGGCTGG - Intronic
1129205121 15:74032912-74032934 TCTCAGCACCCCTGCTGGGCTGG - Intronic
1129685753 15:77685213-77685235 TCACCCCTTCCCTGCTGGGCTGG - Intronic
1130509544 15:84577547-84577569 TCACAACTTCCCTGGGAAGCAGG - Intergenic
1131186928 15:90282384-90282406 TCACAACTGCCCTGGGAAGCAGG + Intronic
1132651131 16:1021879-1021901 TCACACGTCCCCTGGGGGTCTGG + Intergenic
1132930895 16:2458805-2458827 TCACAACACCCCTGTGAGGTAGG - Exonic
1134505483 16:14802605-14802627 TCCCAACAGCCCTGTGGGGCAGG + Intronic
1134575096 16:15326305-15326327 TCACAACAGCCCTGTGGGGCAGG - Intergenic
1134727350 16:16430187-16430209 TCACAACAGCCCTGTGGGGCAGG + Intergenic
1134940087 16:18281668-18281690 TCCCAACAGCCCTGTGGGGCAGG - Intergenic
1135175582 16:20225570-20225592 TCACAGCTACCCTGCGTGGTAGG + Intergenic
1137716126 16:50599309-50599331 TCACAACTGCCCTGCCAGGTGGG + Intronic
1141196354 16:81864587-81864609 TCACATCTGCCCTGGGAGGCGGG - Intronic
1141564128 16:84890008-84890030 TCCCAACAGCCCTGTGGGGCAGG - Intronic
1142146987 16:88496836-88496858 TCAGACCTCCCCTGCAGGACTGG - Intronic
1142419779 16:89963192-89963214 TCACAGCTCCCAGGCTGGGCAGG - Intronic
1142757572 17:2025008-2025030 TCACCATGCCCCTGCGGGGCCGG - Exonic
1143870649 17:9955469-9955491 TCACAACAGCCCTGCAAGGCAGG + Intronic
1145012886 17:19379581-19379603 TCACAACTCCCCTGCGGGGCAGG - Intronic
1145068039 17:19776983-19777005 TCACAACAACCCTGCAAGGCAGG + Intronic
1148026193 17:44589403-44589425 TCACAACCACCCTGTAGGGCGGG + Intergenic
1148232300 17:45944150-45944172 TCACAGCCACCCTGTGGGGCAGG + Intronic
1150124403 17:62627340-62627362 TCACAACTCCCCCGCTGGCGCGG - Intergenic
1150450563 17:65263643-65263665 TCCCAACTCCCCTATGGGGTAGG + Intergenic
1151761247 17:76104317-76104339 GATCAACTTCCCTGCGGGGCTGG + Intronic
1152227440 17:79098932-79098954 TAACAACCCCACTGCAGGGCAGG + Intronic
1154326161 18:13392243-13392265 TCACAAATGCCCTGTGAGGCAGG - Intronic
1155839623 18:30629768-30629790 GCCCAATTCCCCTGCTGGGCAGG - Intergenic
1156312435 18:35937195-35937217 TGACAACAACCCTGTGGGGCTGG - Intergenic
1157369036 18:47093205-47093227 TCACAACAACCCTGTGAGGCAGG - Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1161321095 19:3641893-3641915 TCCCAACTCCCCTCTGGGACTGG - Intronic
1163033876 19:14560808-14560830 TCCCCACTCCCCTGCTGGCCTGG - Intronic
1163244635 19:16085719-16085741 TCACAACTGCCCTATGGAGCAGG - Intronic
1163755667 19:19104975-19104997 TCACCACTACCCTGATGGGCTGG + Intronic
1164257773 19:23544274-23544296 TCACAATACCCCTGAGGGGATGG + Intronic
1164282715 19:23782912-23782934 TCACAATACCCCTGAGGGGATGG - Intronic
1164313209 19:24064347-24064369 TCACAATACCCCTGAGGGGTGGG - Intronic
1165707011 19:37983390-37983412 TCACAACTGCTCCGTGGGGCAGG - Intronic
1165739024 19:38194753-38194775 TTAAAACTCCCCTGCAGGCCGGG + Intronic
1166158831 19:40936370-40936392 TCACACCTCCCCTGCACTGCAGG + Intergenic
1166288925 19:41849245-41849267 TCCCTACTCACGTGCGGGGCTGG - Exonic
1168692120 19:58383506-58383528 TCACACCTCTCCTGAGGGCCTGG + Intergenic
925000842 2:401625-401647 TCACAACCACCCTGCAGAGCGGG - Intergenic
925179720 2:1809213-1809235 CCACCACTTCCCTGCAGGGCTGG - Intronic
925962369 2:9029819-9029841 TTACAACTCCCCTCCAAGGCAGG + Intergenic
928178385 2:29050548-29050570 TCACAGCACCCCTGAGAGGCAGG - Intronic
932431950 2:71681391-71681413 TAACAACTACCCTGCAGGGAAGG - Intronic
932599069 2:73111933-73111955 TCTCCACTCCCCTGCCGGACAGG + Intronic
933331683 2:80900177-80900199 TCACAACAGCCCTGTGGGGTAGG + Intergenic
933799772 2:85951610-85951632 TCACAACAACCCTGCGGGGCAGG - Intergenic
934156490 2:89205783-89205805 TCTCAGCTCCCCTGCAGTGCTGG + Intergenic
934210827 2:89976976-89976998 TCTCAGCTCCCCTGCAGTGCTGG - Intergenic
934661876 2:96147386-96147408 ACCCAACTCCCATGCTGGGCTGG + Intergenic
934716269 2:96546483-96546505 TCACAACAACCCTGCGTGGTGGG - Intronic
936281905 2:111148733-111148755 TCACACCACCCCTGTGGGGGTGG - Intronic
937781105 2:125838271-125838293 GAACAACTCCCCTGTGGTGCTGG + Intergenic
939171935 2:138706208-138706230 TCACAACAACCCTGAGAGGCAGG + Intronic
941849141 2:170161777-170161799 TCTCAACTCCCCTCCTGGACTGG + Intergenic
945030318 2:205657069-205657091 TCACTACACCCCTGCGAGGGGGG + Intergenic
946323775 2:218971337-218971359 TCACAATTCCCCTGCTGATCAGG + Intergenic
946413777 2:219529163-219529185 TCACAACTACCCTGTGAGGTGGG - Intronic
948170525 2:235898167-235898189 TATCAAGTGCCCTGCGGGGCAGG - Intronic
948808096 2:240461552-240461574 AGACATCTCCCCTGCTGGGCAGG - Intronic
1168765345 20:378530-378552 TGGCAACTCCCCTGCTGGGGAGG - Intronic
1173159391 20:40641094-40641116 TCACAACTCACCTGTGAGGTGGG + Intergenic
1173215085 20:41073738-41073760 TCACAACACTCCTGTGAGGCAGG - Intronic
1173247288 20:41345418-41345440 TCACAACAACCCTGTGGGGCTGG - Intronic
1174239636 20:49123097-49123119 TCACAAACTCCCTGCGGCGCGGG + Exonic
1175580341 20:60094022-60094044 TCAGAACTTCCTTGAGGGGCAGG - Intergenic
1176268213 20:64221697-64221719 AGACAACACCCCTGAGGGGCTGG - Intronic
1179011989 21:37563473-37563495 CTGCAACTACCCTGCGGGGCGGG - Intergenic
1181058017 22:20268886-20268908 TCACACCGCCCGTGGGGGGCTGG - Intronic
1181176744 22:21042155-21042177 TCACATATCCCCTGCCTGGCAGG - Intergenic
1182662454 22:31934572-31934594 TCACAACAGCCCTGCGTGGTGGG - Intronic
1182723171 22:32420874-32420896 TCACTACAGCCCTGCGAGGCAGG - Intronic
1184377059 22:44120219-44120241 TCACAACAGCCCTGGGGGTCTGG + Intronic
1184706181 22:46215035-46215057 TCAGAACACCCATGCGGGGCCGG - Intronic
1185369287 22:50453424-50453446 TCACAACTTCCCTGTAAGGCAGG + Intronic
949925122 3:9034962-9034984 TCACAACAACCCTGTGAGGCTGG + Intronic
950107270 3:10396267-10396289 CCACAACAGCCCTGTGGGGCAGG + Intronic
950556533 3:13699326-13699348 ACATACCTCCCCTGCTGGGCAGG - Intergenic
951540152 3:23774809-23774831 TCACAACTCAACTACTGGGCGGG + Intergenic
952284486 3:31955280-31955302 TCACAACTTCCCTGCAAGGTAGG + Intronic
952408001 3:33022420-33022442 TCACAGCTACCCTGTGAGGCAGG + Intronic
952613819 3:35245172-35245194 TCACATCACCCCTCCAGGGCAGG + Intergenic
953253870 3:41270306-41270328 TCACAGCTCCCCAGCTGGGTTGG - Intronic
961169703 3:124788283-124788305 TCACAACTCCCTTCTGGGGTAGG + Intronic
961708238 3:128806626-128806648 TCACAAGGCCCCTGGGGAGCAGG - Intronic
962863164 3:139423415-139423437 TCCCAACTCCCCTACTGGGGTGG + Intergenic
967604117 3:191424131-191424153 TCACAACTCCTCTGCGAGGTAGG + Intergenic
969054578 4:4393664-4393686 TCACAACTGCCCTGAAGGGGTGG + Intronic
969813764 4:9670921-9670943 TCACAGCTCCGCCGTGGGGCTGG + Intergenic
970043143 4:11819284-11819306 TCACAACAACCCTGCATGGCAGG - Intergenic
970189323 4:13496815-13496837 TCACAACTCACCAGCAAGGCTGG + Intergenic
970455479 4:16219453-16219475 TCAGAACTCACCGGCAGGGCTGG - Intronic
971104780 4:23512412-23512434 TCCCAATGCCCCTGCTGGGCTGG - Intergenic
973804673 4:54514196-54514218 TCACAACAACCCTGGGGGACAGG - Intergenic
973936400 4:55850843-55850865 TCACAACTACCCTGTGAGGAAGG - Intergenic
974277737 4:59747879-59747901 TCCTAAATCACCTGCGGGGCTGG + Intergenic
978222843 4:106297885-106297907 TCACAACAACCCTGTGAGGCAGG - Intronic
979600734 4:122584056-122584078 TCACAGCGTGCCTGCGGGGCAGG + Intergenic
985070696 4:186164407-186164429 TAACAGCTCCCCTGCAGGCCGGG - Intronic
985672999 5:1215918-1215940 TCACCACACCCCTGCTGGGATGG - Intronic
985868908 5:2538406-2538428 CCACAGCTCCCCTGCTGGGCCGG - Intergenic
991694252 5:69255012-69255034 TCACAACTTCCCTATGAGGCAGG - Intronic
998131617 5:139654161-139654183 TCACAACTGCCGTGGGGGGTTGG - Intronic
1001327591 5:170740480-170740502 TCATGACAACCCTGCGGGGCAGG + Intergenic
1001846431 5:174925884-174925906 TCACAACTGCCCTGGGAAGCAGG - Intergenic
1006478407 6:34272797-34272819 TCACATCTACCCTGAGAGGCAGG - Intergenic
1011616040 6:89199250-89199272 TCACAACTGCCCTGGGCGGTGGG - Intronic
1013112339 6:107074039-107074061 TCACAACCACCCTGTGGGACAGG - Intronic
1018183572 6:161245290-161245312 TCCCATCACCCCTGTGGGGCCGG - Intronic
1019187614 6:170229993-170230015 GCAAAACTGCCCTGCTGGGCGGG - Intergenic
1019275710 7:174488-174510 TCACAGCTCCTCTGCCAGGCAGG + Intergenic
1019635404 7:2072911-2072933 TCACATCTGCTCTGCGTGGCGGG - Intronic
1020131638 7:5562238-5562260 TCACAATTTCCCTGCTGAGCTGG - Intronic
1022423127 7:30242936-30242958 TCACAACAGCCCTGCTAGGCAGG - Intergenic
1025236542 7:57238346-57238368 TCACAACTGCCCTGTGTGGGAGG - Intergenic
1025664350 7:63574264-63574286 TCAGAACGGCCCTGCGGTGCAGG + Intergenic
1027363481 7:77433113-77433135 TCAGAACTCCCCAGGGGAGCTGG + Intergenic
1027603684 7:80272397-80272419 TCACAGCTACCCTGTGAGGCTGG + Intergenic
1030490439 7:110226130-110226152 TCACACTTCCCCAGCAGGGCAGG + Intergenic
1031179655 7:118398127-118398149 TCACAACAACCCTGCGAGGTAGG - Intergenic
1032405879 7:131655083-131655105 TCACGACTGCCCTGGGAGGCAGG - Intergenic
1032654085 7:133908632-133908654 TCACAACCACCCTGCGTGGTAGG - Intronic
1032807000 7:135365476-135365498 TCACAACAGCCCTGAGAGGCAGG + Intronic
1034142703 7:148837087-148837109 TCACAACTACCCTGTGAGGTAGG + Intronic
1035430968 7:158821585-158821607 TCAGAACTGCCCTGAGGGCCTGG + Intronic
1035678923 8:1473391-1473413 TCTCAGATCCACTGCGGGGCTGG + Intergenic
1036658089 8:10690659-10690681 GCGCCACACCCCTGCGGGGCTGG - Intronic
1036682974 8:10889302-10889324 TCACAACACCCCTGTGAGGTAGG + Intergenic
1037915765 8:22772447-22772469 TCACAACAACCTTGTGGGGCAGG + Intronic
1041243888 8:55872872-55872894 TCAAAACTCTCCTGCTGGGTTGG + Intergenic
1047772007 8:128037192-128037214 TCACCACTCCTCTGAGGGGCAGG + Intergenic
1048255773 8:132904169-132904191 TCACAACAACTCTGTGGGGCTGG - Intronic
1049298736 8:141857675-141857697 TCACAACTACCCTTTGAGGCAGG - Intergenic
1049741352 8:144242533-144242555 CCCCAGCTCCCCTGCGTGGCAGG - Intronic
1053097705 9:35343226-35343248 TCACAACAACCCTGTGAGGCAGG - Intronic
1053878456 9:42567476-42567498 ACACAACTACCCTACGGGGTAGG + Intergenic
1053894207 9:42726901-42726923 ACACAACTACCCTACGGGGTAGG - Intergenic
1054233236 9:62534219-62534241 ACACAACTACCCTACGGGGTAGG - Intergenic
1057745596 9:97748535-97748557 TCACAACAGCCCTGTGGGTCAGG + Intergenic
1057796797 9:98163521-98163543 TCACAACTCTCCTGCAAGGTAGG + Intronic
1057808695 9:98240933-98240955 TCACCACTCCCATGCTGGCCAGG - Intronic
1058495216 9:105551432-105551454 TCACAACAGCCCTGTGAGGCAGG - Intronic
1061377906 9:130236896-130236918 TCACCAGGCCCCTGCGAGGCAGG - Exonic
1061574373 9:131496893-131496915 ACACAGCACCCCTGCAGGGCAGG - Exonic
1061727616 9:132590105-132590127 TCCCCACTCCCAGGCGGGGCAGG + Exonic
1061929281 9:133824167-133824189 TCAGCACTTCCCTGTGGGGCTGG - Intronic
1062611139 9:137374022-137374044 TCCCAAATCTCCTGCGGGTCAGG - Intronic
1187699642 X:21952873-21952895 TCCCAACTACCTTGCGGGGCGGG - Intronic
1191044168 X:56118215-56118237 TCACAACAGCCCTGTGGGGTAGG - Intergenic
1191689968 X:63929502-63929524 TCACAACTACTCTGCGAGTCAGG - Intergenic