ID: 1145014072

View in Genome Browser
Species Human (GRCh38)
Location 17:19385553-19385575
Sequence AACCCAGTCCTTTAACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145014072_1145014082 -6 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014082 17:19385570-19385592 TGGGTTGGGGGTGGGGAGGGTGG 0: 2
1: 4
2: 113
3: 944
4: 5992
1145014072_1145014086 4 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014086 17:19385580-19385602 GTGGGGAGGGTGGTGGGAGTGGG 0: 1
1: 1
2: 34
3: 296
4: 2896
1145014072_1145014080 -10 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014080 17:19385566-19385588 GGACTGGGTTGGGGGTGGGGAGG 0: 2
1: 4
2: 36
3: 396
4: 2634
1145014072_1145014084 -2 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014084 17:19385574-19385596 TTGGGGGTGGGGAGGGTGGTGGG 0: 1
1: 1
2: 44
3: 401
4: 3171
1145014072_1145014088 29 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014088 17:19385605-19385627 TGCTAAAACAACGTCCACATTGG 0: 1
1: 0
2: 0
3: 7
4: 53
1145014072_1145014085 3 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014085 17:19385579-19385601 GGTGGGGAGGGTGGTGGGAGTGG 0: 1
1: 5
2: 70
3: 583
4: 4753
1145014072_1145014087 5 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014087 17:19385581-19385603 TGGGGAGGGTGGTGGGAGTGGGG 0: 1
1: 1
2: 36
3: 395
4: 2995
1145014072_1145014081 -9 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014081 17:19385567-19385589 GACTGGGTTGGGGGTGGGGAGGG 0: 1
1: 2
2: 36
3: 353
4: 2418
1145014072_1145014083 -3 Left 1145014072 17:19385553-19385575 CCAGTTTGTTAAAGGACTGGGTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1145014083 17:19385573-19385595 GTTGGGGGTGGGGAGGGTGGTGG 0: 2
1: 8
2: 84
3: 1083
4: 13168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145014072 Original CRISPR AACCCAGTCCTTTAACAAAC TGG (reversed) Intronic
901762840 1:11481661-11481683 CAGGCAGTCCTTTAACAGACGGG - Intronic
905724655 1:40240621-40240643 AACCCAATCATTAAACCAACTGG - Exonic
907602752 1:55787325-55787347 GACCCAGTACTTTAACAACTGGG - Intergenic
911688647 1:100806266-100806288 AACACTGTGCTTTAACCAACAGG + Intergenic
914251242 1:145923609-145923631 AACCCAGCAATTTAACAAAAAGG + Intergenic
915986686 1:160473091-160473113 AACCGAGTCCTTGAGCAATCTGG + Intergenic
922240474 1:223752394-223752416 ATCCCAGCCCCTTAAGAAACTGG + Intronic
1068950650 10:62773674-62773696 ACTCCAGTCATTTAACAAAGAGG + Intergenic
1069575307 10:69523282-69523304 AACCCAGTAATTAAACAAAAGGG + Intergenic
1069821461 10:71231067-71231089 AACCCCCTCATTTAACAGACAGG - Intronic
1070271265 10:74957699-74957721 AACCCGGTCCTCTTACTAACGGG - Intronic
1074248900 10:111724069-111724091 AAACCATTCCTGTAACAATCAGG + Intergenic
1074926979 10:118083516-118083538 GACCCACTCCTTTTACAAATGGG + Intergenic
1075523692 10:123163712-123163734 AACACAGCCCTTTATCCAACAGG - Intronic
1075596181 10:123731001-123731023 AACCCACTGCTTTCACAAACAGG + Intronic
1075937329 10:126353603-126353625 AACTCAGCTCTTTAATAAACAGG - Intronic
1076491323 10:130863526-130863548 CACCCAATCCTTTAAAAAACGGG - Intergenic
1076976785 11:178432-178454 AACCCTGTCCTTTATTACACAGG + Intronic
1078354201 11:10622225-10622247 AACCCACTGCTTTAAGGAACAGG + Intronic
1078916493 11:15783547-15783569 AGCCCAGTCCTCTAGCAAGCTGG - Intergenic
1082698154 11:56396399-56396421 CTCCCAGTCCTCTAACCAACTGG + Intergenic
1088856361 11:113758381-113758403 AACCCAATCCCTTAATAAAAGGG + Intronic
1092846010 12:12585980-12586002 AATCAAGATCTTTAACAAACAGG - Intergenic
1093097288 12:14985707-14985729 TACCCAGTGCTGAAACAAACAGG - Intergenic
1093886848 12:24471258-24471280 ATCCCAGTTCTTTAACATTCTGG - Intergenic
1094304225 12:28999533-28999555 AACTCAGTCATGGAACAAACTGG - Intergenic
1096834250 12:54338814-54338836 AACCCAGTCTTTTGACAACAAGG - Intronic
1099259264 12:80356251-80356273 AACCCACTCATCTAACAAAGTGG - Intronic
1100031542 12:90198496-90198518 AACCCAGCTCTTTCATAAACCGG + Intergenic
1102264208 12:111468128-111468150 AACCTAAGCCTTTAGCAAACAGG + Intronic
1102417090 12:112773275-112773297 AACCCCATCCTTCAACAAAAGGG - Intronic
1102426523 12:112848366-112848388 AAACCAGTCCTATAACAGTCAGG + Intronic
1105021386 12:132818849-132818871 AACCCAGGCCTTTACCCAGCAGG - Intronic
1107313711 13:39108111-39108133 AACCCATTCTTTTAACAGAAAGG - Intergenic
1107926536 13:45268326-45268348 AATCAAGTCCTTTCACAAATAGG - Intronic
1108094482 13:46886779-46886801 AATCTGTTCCTTTAACAAACTGG - Intronic
1112131948 13:96534216-96534238 CACCCATTCCTTTGACATACAGG - Intronic
1112794044 13:103035181-103035203 TACCCAGTCCTTTAAATCACTGG + Intergenic
1113261004 13:108562886-108562908 AACACAGTCCGTTAACAATGAGG - Intergenic
1114356995 14:21921494-21921516 TATTCAGTCCTTTAACCAACAGG - Intergenic
1114884999 14:26837967-26837989 AACCCATTTCTATACCAAACTGG + Intergenic
1121148141 14:91604617-91604639 CACCCAGTCCTGGAACAATCAGG - Intronic
1122992966 14:105247441-105247463 AACCCAGTTTTTTAAAAAACGGG - Intronic
1125083026 15:35697775-35697797 ACCCCAGTCCTTTCACAGAGAGG - Intergenic
1125862437 15:43011738-43011760 AACCCAGCCCTTTCACTTACTGG + Intronic
1125906739 15:43399938-43399960 CACCCACTCCTCTCACAAACAGG - Intronic
1129794413 15:78365165-78365187 AACCAAGAGCTTTAACAAAGAGG - Intergenic
1130038795 15:80386350-80386372 AATCCAGTGCTTTAACAATGGGG - Intronic
1130346824 15:83054983-83055005 AACCCTCTCATTTTACAAACGGG - Intronic
1130814901 15:87421057-87421079 ATCCCAGTTCTTCAACTAACTGG + Intergenic
1132168934 15:99627564-99627586 AACTCAGTAGTCTAACAAACTGG + Intronic
1134770390 16:16804128-16804150 AACCCTGACCTTTAAATAACAGG + Intergenic
1135893891 16:26381038-26381060 AACTCAGTCCTTTGACACAATGG - Intergenic
1137322968 16:47404490-47404512 ACCCTATTCCCTTAACAAACAGG + Intronic
1137852798 16:51763190-51763212 TACCCAGTCCCATAACAAACAGG + Intergenic
1138139331 16:54554149-54554171 AACGTAGTCCTCTAACAAATAGG + Intergenic
1139527930 16:67528180-67528202 AACCCAGTCCTTTCCAAAGCCGG - Intronic
1142443632 16:90119742-90119764 AACCCTGTCCTTTATTACACAGG - Intergenic
1142463798 17:115473-115495 AACCCTGTCCTTTATTACACAGG + Intergenic
1143160023 17:4863527-4863549 AACCCGGTCCTTTAGGCAACAGG + Intronic
1145014072 17:19385553-19385575 AACCCAGTCCTTTAACAAACTGG - Intronic
1146254219 17:31380230-31380252 AATCAAGTCCGTTAACAGACTGG + Intronic
1148536287 17:48441827-48441849 AACTGAGTCCTTTAATAAAAAGG - Intergenic
1149870252 17:60174547-60174569 AACCCAGGCCTATAAGAACCTGG - Intergenic
1153878725 18:9401880-9401902 AACCTAGTGCTTTAAAAATCTGG - Exonic
1155753516 18:29459705-29459727 AATCCTATCCTTTAAGAAACTGG - Intergenic
1157783887 18:50464872-50464894 AAGCCAGGCCTATAACAACCAGG - Intergenic
1158406320 18:57162973-57162995 AACCCAGGACTTTAAGAAACTGG + Intergenic
1161903786 19:7139688-7139710 AAGCCATTCATTTAGCAAACAGG + Intronic
1163980940 19:20899503-20899525 CACCCAATCATTTATCAAACTGG + Intergenic
1167652194 19:50738107-50738129 AACCCCGTCCATCAACAACCAGG - Intergenic
1167653283 19:50745846-50745868 AACCCCGTCCATCAACAAGCAGG + Intergenic
926977672 2:18531500-18531522 ACCCCAGTCCTTTATAAACCTGG - Intergenic
929218954 2:39443727-39443749 AAACCAGTATTTTAAAAAACAGG + Intergenic
931045619 2:58349255-58349277 GTCCCTGTCCTATAACAAACAGG - Intergenic
938752262 2:134343966-134343988 AACCTAGTTCTTTCATAAACAGG + Intronic
947557431 2:231107889-231107911 ATATCAGTCATTTAACAAACAGG + Intronic
1169951596 20:11050107-11050129 GACCCAGTTATTTAACAACCTGG - Intergenic
1172784423 20:37457623-37457645 AAACAAGTCCATTAAAAAACGGG - Intergenic
1175577625 20:60074002-60074024 AACCCAGTCCCTGGAAAAACTGG - Intergenic
1178575918 21:33790973-33790995 TACCCAGTCCTTTCACATAGGGG - Intronic
1184985796 22:48132762-48132784 AACCTAGTCCTTGAAAAAAAAGG + Intergenic
950942889 3:16911541-16911563 AACCCAGATCTTTAAGAAAGAGG + Intronic
952055308 3:29437019-29437041 AACCCAGTCTTTTAAGAAAGAGG - Intronic
954284570 3:49609726-49609748 AAGCCAGGCCTTTTTCAAACAGG + Intronic
954851038 3:53600846-53600868 AACCAAGTCCTTCAGCGAACAGG - Intronic
960514708 3:118590576-118590598 AAACCAGTCCTTAGACAAAAGGG - Intergenic
966686574 3:182702322-182702344 AACACAGTCCTATAAAAAAGTGG - Intergenic
967298816 3:187991929-187991951 AATCCATTTCTTTAACAACCAGG + Intergenic
968363923 3:198170791-198170813 AACCCTGTCCTTTATTACACAGG - Intergenic
969890686 4:10257087-10257109 AACCAAGTCCTTTCATAAATAGG - Intergenic
970083326 4:12315622-12315644 ACCCCTTTCCTGTAACAAACAGG + Intergenic
973532366 4:51845183-51845205 AACCCAGTGCTTACACACACTGG - Intronic
973963739 4:56138680-56138702 TAACCTGTCCTTTTACAAACAGG - Intergenic
977733883 4:100388026-100388048 AACCCAGGCCTTTAATATAAAGG + Intergenic
980095956 4:128491041-128491063 AACCCAGGCCTTGAACATAGGGG + Intergenic
981125282 4:141098798-141098820 AACCCAGTCCTTGTACAATGAGG - Intronic
986227116 5:5826290-5826312 CACCCATTCATCTAACAAACTGG - Intergenic
986622534 5:9690919-9690941 AACACAGTCCATTCAAAAACAGG + Intronic
987484746 5:18510785-18510807 AAAACAAACCTTTAACAAACTGG + Intergenic
993810935 5:92474719-92474741 AAGCAAGTCCTTTACCAAGCAGG - Intergenic
995548973 5:113261733-113261755 AACCCAGTCTTTTGGCAGACAGG + Intronic
997593648 5:135091763-135091785 AACCATCTCCTTTAACAAATGGG + Intronic
1000110907 5:158107374-158107396 AGCCCATTCCTTTAACTACCAGG + Intergenic
1004679417 6:17878288-17878310 AACACAGTCCTTGAACACACAGG - Intronic
1005908533 6:30287366-30287388 AACCCACTCCATTAAAAAATGGG - Intergenic
1007291375 6:40789704-40789726 AATCCAGTCCTTTACCAAGAGGG + Intergenic
1009932126 6:70188569-70188591 AACCCACGCTTTTAACATACAGG + Intronic
1011150995 6:84273253-84273275 AACCCAATCCGTTCATAAACTGG - Intergenic
1011369211 6:86614676-86614698 AGCCCAGTGCTTTACCAAAGCGG + Intergenic
1011689670 6:89855064-89855086 AAAACATTCCTTTAAAAAACAGG - Intronic
1013736516 6:113233752-113233774 ATTCCAGACCTTTAAGAAACAGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019251890 7:18873-18895 AACCCTGTCCTTTATTACACAGG + Intergenic
1020144210 7:5630333-5630355 AACCCACTCCTTTCCAAAACAGG + Intronic
1020366287 7:7384206-7384228 AACCCAGTGCAGTAACATACTGG + Intronic
1022312803 7:29212979-29213001 CACCCAGTCCTGGAACAATCAGG + Intronic
1026474964 7:70727329-70727351 AACCCAGCCCTGTGGCAAACAGG - Intronic
1027207918 7:76117849-76117871 AAGCCAGTCCTTCCATAAACCGG - Intergenic
1033153320 7:138935527-138935549 AACACAGTCCTGTAACAACAGGG + Intronic
1034003015 7:147437346-147437368 AACCCTGTCCTTTAACCATATGG + Intronic
1046040313 8:108895650-108895672 ATACCAGTACTTTAACAAATTGG + Intergenic
1050059335 9:1688668-1688690 AACCCATTCCTTTTATAAATAGG - Intergenic
1052173124 9:25426281-25426303 AACTCAGTTCTTTAACTCACAGG + Intergenic
1058386853 9:104446583-104446605 AACAAACTCCATTAACAAACTGG - Intergenic
1058657573 9:107237531-107237553 TACCCTTTCCTTTAACAAAATGG - Intergenic
1062748622 9:138234736-138234758 AACCCTGTCCTTTATTACACAGG - Intergenic
1189670909 X:43407873-43407895 CACCCAGTCCTGGAACAATCAGG - Intergenic
1190274679 X:48892143-48892165 AAGCCAGTCCCTTACAAAACTGG - Intergenic
1191873753 X:65772948-65772970 CACCCAGTCCTGGAACAATCAGG - Intergenic
1193838830 X:86382898-86382920 CCCACAGTCCGTTAACAAACAGG - Intronic
1198284854 X:135179134-135179156 CCCCCAGTCCTTGAATAAACAGG - Intergenic
1199053462 X:143264602-143264624 AGCCTAGTCCTTAAGCAAACTGG + Intergenic
1202046405 Y:20740569-20740591 AAACCAGTTATTTAAAAAACTGG - Intergenic
1202174891 Y:22088645-22088667 AACTCAGCTCTGTAACAAACTGG + Intronic
1202216471 Y:22497737-22497759 AACTCAGCTCTGTAACAAACTGG - Intronic
1202326717 Y:23698332-23698354 AACTCAGCTCTGTAACAAACTGG + Intergenic
1202544053 Y:25971721-25971743 AACTCAGCTCTGTAACAAACCGG - Intergenic