ID: 1145017255

View in Genome Browser
Species Human (GRCh38)
Location 17:19407559-19407581
Sequence GGTCCTGGGTCCATGTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145017255_1145017272 16 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017272 17:19407598-19407620 CTGGGCCAGGGGTTCCCCTTGGG No data
1145017255_1145017271 15 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017271 17:19407597-19407619 CCTGGGCCAGGGGTTCCCCTTGG No data
1145017255_1145017265 4 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017265 17:19407586-19407608 CACCTGGCCTCCCTGGGCCAGGG No data
1145017255_1145017262 -2 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017262 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
1145017255_1145017273 17 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data
1145017255_1145017264 3 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017264 17:19407585-19407607 ACACCTGGCCTCCCTGGGCCAGG No data
1145017255_1145017260 -3 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017260 17:19407579-19407601 ACCACCACACCTGGCCTCCCTGG No data
1145017255_1145017266 5 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017266 17:19407587-19407609 ACCTGGCCTCCCTGGGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145017255 Original CRISPR GGTCCTGGGTCCATGTCTAT GGG (reversed) Intergenic
No off target data available for this crispr