ID: 1145017260

View in Genome Browser
Species Human (GRCh38)
Location 17:19407579-19407601
Sequence ACCACCACACCTGGCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145017256_1145017260 -4 Left 1145017256 17:19407560-19407582 CCATAGACATGGACCCAGGACCA No data
Right 1145017260 17:19407579-19407601 ACCACCACACCTGGCCTCCCTGG No data
1145017255_1145017260 -3 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017260 17:19407579-19407601 ACCACCACACCTGGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145017260 Original CRISPR ACCACCACACCTGGCCTCCC TGG Intergenic
No off target data available for this crispr