ID: 1145017261

View in Genome Browser
Species Human (GRCh38)
Location 17:19407580-19407602
Sequence CCCAGGGAGGCCAGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145017261_1145017271 -6 Left 1145017261 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
Right 1145017271 17:19407597-19407619 CCTGGGCCAGGGGTTCCCCTTGG No data
1145017261_1145017273 -4 Left 1145017261 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data
1145017261_1145017278 15 Left 1145017261 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
Right 1145017278 17:19407618-19407640 GGGGCCCTAGATAGCATCAGAGG No data
1145017261_1145017272 -5 Left 1145017261 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
Right 1145017272 17:19407598-19407620 CTGGGCCAGGGGTTCCCCTTGGG No data
1145017261_1145017281 22 Left 1145017261 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145017261 Original CRISPR CCCAGGGAGGCCAGGTGTGG TGG (reversed) Intergenic
No off target data available for this crispr