ID: 1145017264

View in Genome Browser
Species Human (GRCh38)
Location 17:19407585-19407607
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145017256_1145017264 2 Left 1145017256 17:19407560-19407582 CCATAGACATGGACCCAGGACCA No data
Right 1145017264 17:19407585-19407607 ACACCTGGCCTCCCTGGGCCAGG No data
1145017255_1145017264 3 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017264 17:19407585-19407607 ACACCTGGCCTCCCTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145017264 Original CRISPR ACACCTGGCCTCCCTGGGCC AGG Intergenic