ID: 1145017266

View in Genome Browser
Species Human (GRCh38)
Location 17:19407587-19407609
Sequence ACCTGGCCTCCCTGGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145017256_1145017266 4 Left 1145017256 17:19407560-19407582 CCATAGACATGGACCCAGGACCA No data
Right 1145017266 17:19407587-19407609 ACCTGGCCTCCCTGGGCCAGGGG No data
1145017255_1145017266 5 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017266 17:19407587-19407609 ACCTGGCCTCCCTGGGCCAGGGG No data
1145017259_1145017266 -10 Left 1145017259 17:19407574-19407596 CCAGGACCACCACACCTGGCCTC No data
Right 1145017266 17:19407587-19407609 ACCTGGCCTCCCTGGGCCAGGGG No data
1145017258_1145017266 -9 Left 1145017258 17:19407573-19407595 CCCAGGACCACCACACCTGGCCT No data
Right 1145017266 17:19407587-19407609 ACCTGGCCTCCCTGGGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145017266 Original CRISPR ACCTGGCCTCCCTGGGCCAG GGG Intergenic
No off target data available for this crispr