ID: 1145017273

View in Genome Browser
Species Human (GRCh38)
Location 17:19407599-19407621
Sequence TGGGCCAGGGGTTCCCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145017263_1145017273 -7 Left 1145017263 17:19407583-19407605 CCACACCTGGCCTCCCTGGGCCA No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data
1145017258_1145017273 3 Left 1145017258 17:19407573-19407595 CCCAGGACCACCACACCTGGCCT No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data
1145017259_1145017273 2 Left 1145017259 17:19407574-19407596 CCAGGACCACCACACCTGGCCTC No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data
1145017256_1145017273 16 Left 1145017256 17:19407560-19407582 CCATAGACATGGACCCAGGACCA No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data
1145017255_1145017273 17 Left 1145017255 17:19407559-19407581 CCCATAGACATGGACCCAGGACC No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data
1145017261_1145017273 -4 Left 1145017261 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
Right 1145017273 17:19407599-19407621 TGGGCCAGGGGTTCCCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145017273 Original CRISPR TGGGCCAGGGGTTCCCCTTG GGG Intergenic
No off target data available for this crispr