ID: 1145017281

View in Genome Browser
Species Human (GRCh38)
Location 17:19407625-19407647
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145017259_1145017281 28 Left 1145017259 17:19407574-19407596 CCAGGACCACCACACCTGGCCTC No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017269_1145017281 6 Left 1145017269 17:19407596-19407618 CCCTGGGCCAGGGGTTCCCCTTG No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017258_1145017281 29 Left 1145017258 17:19407573-19407595 CCCAGGACCACCACACCTGGCCT No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017263_1145017281 19 Left 1145017263 17:19407583-19407605 CCACACCTGGCCTCCCTGGGCCA No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017261_1145017281 22 Left 1145017261 17:19407580-19407602 CCACCACACCTGGCCTCCCTGGG No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017274_1145017281 -1 Left 1145017274 17:19407603-19407625 CCAGGGGTTCCCCTTGGGGCCCT No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017268_1145017281 9 Left 1145017268 17:19407593-19407615 CCTCCCTGGGCCAGGGGTTCCCC No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017270_1145017281 5 Left 1145017270 17:19407597-19407619 CCTGGGCCAGGGGTTCCCCTTGG No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017267_1145017281 14 Left 1145017267 17:19407588-19407610 CCTGGCCTCCCTGGGCCAGGGGT No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data
1145017275_1145017281 -10 Left 1145017275 17:19407612-19407634 CCCCTTGGGGCCCTAGATAGCAT No data
Right 1145017281 17:19407625-19407647 TAGATAGCATCAGAGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145017281 Original CRISPR TAGATAGCATCAGAGGCCTC TGG Intergenic
No off target data available for this crispr