ID: 1145020927

View in Genome Browser
Species Human (GRCh38)
Location 17:19430092-19430114
Sequence CAAAACAAGGAGAAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145020923_1145020927 11 Left 1145020923 17:19430058-19430080 CCTTCTAGATGGCTTTATGTGGC No data
Right 1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG No data
1145020921_1145020927 12 Left 1145020921 17:19430057-19430079 CCCTTCTAGATGGCTTTATGTGG No data
Right 1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145020927 Original CRISPR CAAAACAAGGAGAAGCAGGG AGG Intergenic
No off target data available for this crispr