ID: 1145023913

View in Genome Browser
Species Human (GRCh38)
Location 17:19453396-19453418
Sequence CACGAGGCCCACAGCAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145023913_1145023925 20 Left 1145023913 17:19453396-19453418 CCCCAGCTGCTGTGGGCCTCGTG 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1145023925 17:19453439-19453461 CTCCAGCAAAACCTCAGCCAAGG No data
1145023913_1145023926 21 Left 1145023913 17:19453396-19453418 CCCCAGCTGCTGTGGGCCTCGTG 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1145023926 17:19453440-19453462 TCCAGCAAAACCTCAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145023913 Original CRISPR CACGAGGCCCACAGCAGCTG GGG (reversed) Intergenic
900662383 1:3791246-3791268 CACGAGGCTTAAAGCAGCAGCGG - Intronic
900728608 1:4235977-4235999 CTCCAGGCCAACTGCAGCTGTGG - Intergenic
903367575 1:22814655-22814677 CACAAAGCCAACCGCAGCTGAGG + Intronic
903999829 1:27332620-27332642 CACCAGGCCCACAGCTGAGGTGG - Intronic
904032667 1:27543030-27543052 GACAAAGCCCAGAGCAGCTGCGG + Intronic
907304688 1:53506990-53507012 CAGGGGGCCCAGGGCAGCTGGGG + Intronic
909965466 1:81904507-81904529 CATGAGGCCCTCACCAGATGTGG - Intronic
912796519 1:112696681-112696703 CAGGAGACCCTCGGCAGCTGGGG + Exonic
913024150 1:114819038-114819060 CAGGAGGCCCAGAGCAGCCTGGG - Intergenic
913343882 1:117788504-117788526 AACAAGGCCCAAAGAAGCTGGGG + Intergenic
916733552 1:167587357-167587379 GACTAGACCCACAGCTGCTGTGG - Intergenic
920187920 1:204173332-204173354 CACCAGCTCCACACCAGCTGTGG + Intergenic
1068338306 10:55667277-55667299 AAAGAGGCCCTCAGCTGCTGGGG - Intergenic
1068525819 10:58128134-58128156 CACAAGGGCCACAGAAGCAGGGG + Intergenic
1069024122 10:63521609-63521631 CGCGAGGCCCAGGGGAGCTGTGG + Intronic
1070684812 10:78472552-78472574 CAGGAAGCCCACAGTCGCTGGGG - Intergenic
1071534386 10:86415833-86415855 CTTGATTCCCACAGCAGCTGGGG - Intergenic
1072741905 10:97914786-97914808 CAAGAGGCCTCAAGCAGCTGGGG + Intronic
1072806222 10:98425459-98425481 CATCCGGTCCACAGCAGCTGAGG - Intronic
1072985554 10:100136669-100136691 CAAGAGGCCCTCATCAGATGTGG + Intergenic
1073424833 10:103450073-103450095 CACCAGGCCAACCACAGCTGGGG - Exonic
1073965945 10:108990066-108990088 CATGAGGCCCACACAACCTGTGG - Intergenic
1075451193 10:122552947-122552969 CAAGAGCCCAGCAGCAGCTGGGG - Intergenic
1077080499 11:722721-722743 CAGGAGGCTCCCAGCCGCTGTGG - Exonic
1077130585 11:970407-970429 CACGTGGCTCACGTCAGCTGTGG - Intronic
1077860002 11:6169596-6169618 CACAAGGCCCTCAGCACTTGTGG - Exonic
1079123211 11:17699557-17699579 CATGGGCCCCACAGCAGCTGGGG + Intergenic
1083203359 11:61132977-61132999 CAGGAGGCCCCCAGGGGCTGAGG - Intronic
1083780728 11:64916064-64916086 CACCAGGTCCAGAGCAGCAGGGG - Intronic
1084539343 11:69776353-69776375 CACCAAGCCCCCTGCAGCTGTGG - Intergenic
1085273594 11:75284263-75284285 CACCAGGACCACACCATCTGGGG + Exonic
1085346989 11:75774629-75774651 CAAGAGTCCCACAGCAGTTAGGG - Intronic
1086333195 11:85774496-85774518 CAAGAGGCAAACAGGAGCTGGGG + Intronic
1087461443 11:98453586-98453608 CAAGAGGACCACACCAGCGGAGG - Intergenic
1089353373 11:117834003-117834025 TAGGAGGGCCACAGCACCTGGGG + Intronic
1090355792 11:126139631-126139653 CACTCGGCCCACGGCATCTGAGG + Intergenic
1091327353 11:134701113-134701135 CCCAAGGCCCACAGCAGTGGAGG + Intergenic
1092144612 12:6205837-6205859 CAGTAGGACCACAGAAGCTGTGG - Intronic
1094372370 12:29751830-29751852 CACGCAGCCCACAGCAGCCCGGG - Exonic
1094503066 12:31037398-31037420 CATGTGGCCCACAGCAGAGGTGG + Intergenic
1094841697 12:34345056-34345078 CACGAGGAGCCCAGCAGCTCCGG + Intergenic
1095860915 12:46917257-46917279 CCCAAGGCACACAGCTGCTGAGG + Intergenic
1096148114 12:49293233-49293255 CTCCAGGCCAACAGCAGCTGGGG + Intronic
1096871588 12:54595939-54595961 CAAAAGGACCCCAGCAGCTGAGG - Intergenic
1097178388 12:57156672-57156694 CACAAAGACCACAGCAGCAGGGG + Intronic
1101703128 12:107193977-107193999 CACCAGGCCCTCACCAGATGTGG - Intergenic
1103718408 12:122959988-122960010 CACGAGGCCCGCAGCCGCCGGGG + Exonic
1103719114 12:122964090-122964112 CACGAGGAGAGCAGCAGCTGAGG - Intronic
1104739871 12:131164590-131164612 GGCGAGGCCCTCAGCAGCTGTGG + Intergenic
1104740026 12:131165322-131165344 CATGAGTCCCCCAGCAGGTGGGG + Intergenic
1106140539 13:27007236-27007258 CACAAGCCCCACAACAGCAGAGG - Intergenic
1106295744 13:28412196-28412218 CACGACACCCACAGTAGCAGAGG - Intronic
1106553326 13:30789800-30789822 GAGGAGGACCACAGCAGCTTTGG + Intergenic
1107126826 13:36855620-36855642 CACGAGGCCCTGAGCAGCCCTGG - Intronic
1110896652 13:80761075-80761097 CGGAAGGCCCCCAGCAGCTGAGG - Intergenic
1112049776 13:95633839-95633861 CACGAGGCCGAAGGCAGTTGGGG + Intronic
1112987392 13:105468014-105468036 CAGGAGGCCTCCAGAAGCTGGGG - Intronic
1114256265 14:21003992-21004014 CAGGAGGATCCCAGCAGCTGTGG + Intergenic
1121150263 14:91626679-91626701 CATGAGGCCCTCACCAGATGTGG + Intronic
1121270246 14:92632951-92632973 CAACAGGCTCACAGCACCTGCGG - Intronic
1122238575 14:100346722-100346744 TAAGAGGCCCACTGCTGCTGTGG - Intronic
1122796020 14:104206621-104206643 CATGAGGCCCACACCAGCCCTGG - Intergenic
1123005074 14:105317271-105317293 CACGATGTCCACAGCAGCACGGG - Intronic
1123873034 15:24595655-24595677 CAAGAGGCCCTCACCAGATGTGG - Intergenic
1124434658 15:29637137-29637159 GAAGAGGCCAACAGCATCTGAGG - Intergenic
1124440008 15:29678800-29678822 CAGGAGGACCAGAGCTGCTGGGG - Intergenic
1124483870 15:30099689-30099711 CAGGTGTGCCACAGCAGCTGTGG + Intergenic
1124490242 15:30151008-30151030 CAGGTGTGCCACAGCAGCTGTGG + Intergenic
1124519709 15:30397535-30397557 CAGGTGTGCCACAGCAGCTGTGG - Intergenic
1124538944 15:30568686-30568708 CAGGTGTGCCACAGCAGCTGTGG + Intergenic
1124753291 15:32387321-32387343 CAGGTGTGCCACAGCAGCTGTGG - Intergenic
1124759705 15:32438886-32438908 CAGGTGTGCCACAGCAGCTGTGG - Intergenic
1124975031 15:34523021-34523043 CAGGTGTGCCACAGCAGCTGTGG - Intergenic
1126152645 15:45536907-45536929 CCCCAGGCCCACATCAGGTGAGG + Intergenic
1129115381 15:73362750-73362772 CTCGAAGCTCACAGCAGCTAAGG + Intronic
1129235619 15:74222126-74222148 CCCCAGGCCCACAGCTGTTGTGG - Intergenic
1129828634 15:78652346-78652368 TCTGAGGCACACAGCAGCTGAGG + Intronic
1130988434 15:88860153-88860175 CACCTGGCCCACAGCATCGGGGG - Intronic
1131429721 15:92377179-92377201 CACGGCACCCCCAGCAGCTGGGG - Intergenic
1131507641 15:93031356-93031378 CCTGAGGCCGAGAGCAGCTGGGG - Intergenic
1132152904 15:99475097-99475119 CTCCAGGCTGACAGCAGCTGGGG + Intergenic
1132185305 15:99798257-99798279 CAGGCGTGCCACAGCAGCTGTGG + Intergenic
1136292723 16:29285531-29285553 CTCCAGGGCCACGGCAGCTGGGG + Intergenic
1139480885 16:67230044-67230066 GGTGAGGCCCATAGCAGCTGTGG - Exonic
1139591586 16:67936087-67936109 CTCCAGCCCCACAGCAGCTGAGG + Exonic
1141410442 16:83829412-83829434 CAGGAGGCCAACAGCAGCCTGGG + Intergenic
1142056772 16:88002614-88002636 CATGAGCCCCCCAGAAGCTGTGG + Intronic
1142098611 16:88259535-88259557 CTCCAGGGCCACGGCAGCTGGGG + Intergenic
1142199615 16:88754824-88754846 CCCGGGACCCACAGGAGCTGAGG + Intronic
1143496951 17:7317842-7317864 GACGAGGCCCACAGGCGCAGAGG - Exonic
1143670451 17:8392729-8392751 CAGGAGGCCCACGGCAGCCCTGG - Exonic
1143967592 17:10767859-10767881 CAATAGCCCCACAGGAGCTGAGG - Intergenic
1144776872 17:17789200-17789222 CAGGACGCCCTCAGCAGCAGCGG - Intronic
1144890260 17:18490310-18490332 CACCAGGGACACAGGAGCTGAGG + Intronic
1145023913 17:19453396-19453418 CACGAGGCCCACAGCAGCTGGGG - Intergenic
1145141956 17:20454008-20454030 CACCAGGGACACAGGAGCTGAGG - Intronic
1145367917 17:22279509-22279531 CACCAAGGCCACAGCAGCTGAGG - Intergenic
1145793946 17:27644891-27644913 CACTAGGGACACAGGAGCTGAGG + Intronic
1145808746 17:27752426-27752448 CACCAGGGACACAGGAGCTGAGG + Intergenic
1148795044 17:50192883-50192905 TAGGAGGCCCCGAGCAGCTGAGG + Intronic
1151207584 17:72519275-72519297 CACGAGAGCCTCAGCAGCTAAGG + Intergenic
1151460213 17:74249841-74249863 CAGGAGCCCCACAGTGGCTGAGG - Intronic
1157201858 18:45666262-45666284 CACAGAGCCCACAGCAGATGAGG + Intronic
1157490812 18:48122552-48122574 GAGAAGGCCCAGAGCAGCTGAGG + Intronic
1160956852 19:1697582-1697604 CAAGAGGCTCACATCAGCTTCGG + Intergenic
1161569401 19:5022288-5022310 CACAAGACCCAGAGCACCTGGGG - Intronic
1161676476 19:5653177-5653199 CACGATGTCCACAGCAGAAGAGG + Exonic
1161699823 19:5788440-5788462 CTCCAGGGCCTCAGCAGCTGGGG - Intronic
1161719821 19:5896559-5896581 CACGGCCCCGACAGCAGCTGCGG + Exonic
1163786673 19:19278333-19278355 CAGGAGCCCAACAGCAGCAGAGG + Intronic
1165072745 19:33265016-33265038 CAGGAGGCCCACACCCGCAGGGG - Intergenic
1165449209 19:35872493-35872515 CCCGAGGCCCACAGACGGTGTGG + Exonic
1165986019 19:39769632-39769654 AAAGAGGCCATCAGCAGCTGAGG - Intergenic
1166689966 19:44816465-44816487 CAAGGGGCTCTCAGCAGCTGAGG + Intronic
1167207199 19:48110642-48110664 CAGGAGGACCACAGAAGCTTTGG - Exonic
1167371653 19:49086066-49086088 AGGGAGGCCCAGAGCAGCTGTGG - Intronic
1167521474 19:49958543-49958565 CAGGAGGGGCCCAGCAGCTGTGG + Exonic
1167523901 19:49972177-49972199 CAGGAGGGTCCCAGCAGCTGGGG - Intergenic
925171847 2:1754875-1754897 CTGGAGGCCCACAGAACCTGGGG - Intergenic
925720445 2:6821541-6821563 CTCGAGGCCTGCAGGAGCTGAGG - Intergenic
926053098 2:9757212-9757234 CAGCAGTCCCACATCAGCTGAGG - Intergenic
926116796 2:10218424-10218446 CACCAGGCCCCCAGGAGCAGAGG - Intergenic
929157087 2:38798156-38798178 CATGAAGCCCAAGGCAGCTGAGG - Exonic
932414393 2:71564917-71564939 CACCATGACCACAGCAGCTTTGG - Intronic
932750811 2:74370597-74370619 TAAGGGGCCCACAGCTGCTGGGG - Intronic
934479118 2:94618740-94618762 GACGGGGAGCACAGCAGCTGTGG - Intergenic
934577268 2:95410865-95410887 CACGTGGGCCATAGCATCTGTGG - Exonic
935204666 2:100887419-100887441 CAAGAGGCTCACTGGAGCTGAGG - Intronic
937427173 2:121809754-121809776 CACAGGGCCAGCAGCAGCTGTGG + Intergenic
938086916 2:128407774-128407796 CACGAAGCCCACAGCCTCAGAGG - Intergenic
942121858 2:172785866-172785888 CAAGAGGTCCCCAGAAGCTGTGG + Intronic
942657439 2:178229024-178229046 CACGAGGCCCTCATCAGATGTGG - Intronic
946427248 2:219605950-219605972 CCCCAGGCCTAGAGCAGCTGAGG + Exonic
948061397 2:235045305-235045327 CAGGAGTACCACACCAGCTGTGG + Intronic
948868226 2:240785895-240785917 CAGGAGGCCCAGGGCAGCAGAGG + Intronic
949040028 2:241843905-241843927 CACGAGGCCCACAGGACCCGCGG + Intergenic
1168793433 20:595690-595712 CAGGAGGCGCACTGCAGCTGCGG + Intergenic
1171382142 20:24742156-24742178 CAAGATGCCAACAGCATCTGTGG + Intergenic
1173879522 20:46401342-46401364 CACCATACCAACAGCAGCTGAGG + Intronic
1175031029 20:55954251-55954273 CACGAGGCCCTCACCAGATGTGG - Intergenic
1175746279 20:61459513-61459535 GAGGATTCCCACAGCAGCTGAGG + Intronic
1176300131 21:5095426-5095448 CGCCTGCCCCACAGCAGCTGAGG + Intergenic
1176550073 21:8217150-8217172 CGCGACGCCCGCCGCAGCTGGGG - Intergenic
1176569000 21:8400185-8400207 CGCGACGCCCGCCGCAGCTGGGG - Intergenic
1176576914 21:8444420-8444442 CGCGACGCCCGCCGCAGCTGGGG - Intergenic
1179613431 21:42566671-42566693 AGCGAGCACCACAGCAGCTGTGG + Intronic
1179856891 21:44166485-44166507 CGCCTGCCCCACAGCAGCTGAGG - Intergenic
1179880030 21:44289734-44289756 AACAAGGCCCGCAGCAGCAGTGG + Exonic
1179904589 21:44415837-44415859 CCTGGGGCCCACAGCTGCTGCGG - Intronic
1180960383 22:19759726-19759748 CCCGGGCCCCACAGCAGCTGAGG - Intronic
1181038573 22:20181515-20181537 CAGGTGTCCCACTGCAGCTGGGG - Intergenic
1181529959 22:23511810-23511832 CACGTGGCACCCAGCAGCAGCGG + Intergenic
1183222234 22:36522878-36522900 CATGAGGCCCTCACCAGATGTGG + Intronic
1183412359 22:37662382-37662404 CAGGAGGCCCAGAGCATTTGGGG + Intronic
1184745646 22:46454173-46454195 CAGGTGGCCTCCAGCAGCTGAGG + Intronic
1203254963 22_KI270733v1_random:133476-133498 CGCGACGCCCGCCGCAGCTGGGG - Intergenic
1203263019 22_KI270733v1_random:178555-178577 CGCGACGCCCGCCGCAGCTGGGG - Intergenic
950487288 3:13281255-13281277 CGGGAGACCCACAGCTGCTGTGG + Intergenic
950498466 3:13348708-13348730 CAGGACGCCCTCAGCAGCTGGGG - Intronic
950788643 3:15455424-15455446 CACGAGGCTGACAGCAGCTCTGG + Intronic
951461061 3:22952522-22952544 CCTGAGGCCCACAGCAGATGTGG - Intergenic
952943349 3:38459620-38459642 CTCCAGGCCCACAGCCTCTGCGG - Intronic
953750637 3:45605951-45605973 CACGGAGCCCACAGCATGTGGGG - Intronic
953848089 3:46444733-46444755 CACGGGGCCCACAGCAGGCAGGG + Intronic
954902751 3:54034004-54034026 CACCAGACCCACAGCAGCCCGGG - Intergenic
957200977 3:77135615-77135637 CAGGAGGCCAACAGCAGCCTGGG - Intronic
958950210 3:100408448-100408470 CCCAAAGCCCACAGCTGCTGAGG + Intronic
961674400 3:128555836-128555858 CAGGAAGCCCGCAGCGGCTGCGG + Intergenic
961713936 3:128846263-128846285 CACCAGGGCCACAGCACCTCGGG + Intergenic
961827396 3:129606299-129606321 CACGAGGCCTGCGGCAGCTGCGG + Exonic
963480309 3:145864645-145864667 CAAGAGACTCACAGCAGCTACGG - Intergenic
967568155 3:190995325-190995347 CACCACCCCCACAGAAGCTGGGG - Intergenic
968490266 4:886398-886420 CACCATCCCCACAGCTGCTGGGG + Intronic
972566557 4:40274743-40274765 CAAGAGGCCCACATCTGGTGAGG + Intergenic
977229502 4:94434684-94434706 CAGAAGGCCCTCAGCAGATGTGG + Intergenic
977586153 4:98777882-98777904 CACGAGGCCCTCACTAGATGTGG - Intergenic
980071081 4:128243386-128243408 GAAGAGGCCCACAAAAGCTGGGG + Intergenic
982069790 4:151685333-151685355 CAGGAGGCTGACAGCACCTGTGG + Intronic
985011484 4:185587453-185587475 CCCCAGGCTCACAGCAGCGGCGG + Exonic
985018724 4:185664514-185664536 CACCAGGAGCACAGCAGGTGTGG - Intronic
985903336 5:2813968-2813990 CACGAGGACAACAGCAGCCAGGG + Intergenic
988687538 5:33539590-33539612 CTCAAGACCCACAGCAGCCGTGG + Intronic
994588884 5:101748606-101748628 CAATAGGCCCTCAGAAGCTGAGG - Intergenic
998783868 5:145688110-145688132 CACGATGCCTTCAGCTGCTGTGG + Intronic
1001986085 5:176075281-176075303 CACTGGGCCCAGAGCAGCTATGG + Intronic
1002230783 5:177762843-177762865 CACTGGGCCCAGAGCAGCTATGG - Intronic
1002264553 5:178020905-178020927 CACTGGGCCCAGAGCAGCTATGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1002902354 6:1419766-1419788 CCAGAGTCCCACAGCAGGTGTGG - Intergenic
1003020143 6:2502620-2502642 CAGCAGGCCCACAGCAACTGGGG - Intergenic
1004509885 6:16277000-16277022 CCCCAGGCCTACTGCAGCTGAGG + Intronic
1006321722 6:33323132-33323154 CAGGCGTCCCAAAGCAGCTGGGG + Intronic
1009356924 6:62761171-62761193 CAGGAGGCCAACAGAAGGTGAGG + Intergenic
1012215076 6:96572602-96572624 CACATGGGCCACAGCAGGTGGGG + Intronic
1012986735 6:105883977-105883999 CACTAGGACCACAGCAACAGAGG + Intergenic
1017723334 6:157259399-157259421 CAAGAGGCCCACAGGAGCCCTGG + Intergenic
1017762726 6:157583744-157583766 CAGGATGCCCACTGCAGCTCTGG + Intronic
1017829771 6:158115729-158115751 CACCAGGCCCAGAGCTGCTGAGG - Intronic
1018659664 6:166074155-166074177 CACGAGTCCCACGGCGTCTGAGG + Intergenic
1018877704 6:167839987-167840009 CAAGAGGAGCACTGCAGCTGCGG + Intronic
1019601991 7:1889428-1889450 CAGGAGGACCCCAGCAGCTCTGG + Intronic
1021177475 7:17466534-17466556 CACGATCCCCTCTGCAGCTGTGG - Intergenic
1023844165 7:44111796-44111818 CCCGAGGCCCAGGGCAGCTGAGG - Intronic
1025210145 7:57015608-57015630 CTCCATGCCCACGGCAGCTGGGG + Intergenic
1025661806 7:63561243-63561265 CTCCATGCCCACGGCAGCTGGGG - Intergenic
1029114884 7:98231776-98231798 CACGGGTCCCACAGGAGATGGGG - Intronic
1029155487 7:98514510-98514532 CACGGGGGCACCAGCAGCTGAGG + Intergenic
1030817241 7:114053004-114053026 CTCCAGGACCACAGCAGCAGAGG - Intronic
1031934931 7:127726641-127726663 CACAAAGCCCACAGCAGCCCTGG - Intronic
1032194972 7:129783215-129783237 CACCAGGGACACAGCGGCTGGGG - Intergenic
1033552633 7:142461883-142461905 CAGGAGGACCTCACCAGCTGTGG + Intergenic
1033554954 7:142481168-142481190 CAGGAGGCCCTCAGCAGTTATGG + Intergenic
1033559561 7:142518699-142518721 CAGGAGGCCCTCAGCCGCTATGG + Intergenic
1035049913 7:155992735-155992757 CACATGGCTCACAGCAGATGAGG + Intergenic
1035101651 7:156402401-156402423 GGCCAGTCCCACAGCAGCTGTGG + Intergenic
1035677148 8:1463798-1463820 CACGAGGGCTTCAGGAGCTGTGG + Intergenic
1037883849 8:22586057-22586079 CACGCCGTCCCCAGCAGCTGCGG - Intronic
1039057869 8:33550999-33551021 CAGGAGGGCCCCAGCAGGTGAGG - Intronic
1044509692 8:93060148-93060170 CTGGAGGCCCACAGCAATTGAGG + Intergenic
1048679483 8:136823950-136823972 CAAGAGGCACAAAGGAGCTGTGG + Intergenic
1049209966 8:141381430-141381452 CACCAGGCACACATCTGCTGTGG + Intergenic
1049864307 8:144923973-144923995 CAGGACACCCACTGCAGCTGAGG - Intergenic
1053424918 9:38004359-38004381 CACGCAGCCCCCAGCAGCTCAGG - Intronic
1058847149 9:108972190-108972212 CCCCAGGCCCACATCAGCAGGGG - Intronic
1059501066 9:114754738-114754760 CACCAAGACCACAGCAGCTGAGG + Intergenic
1060927341 9:127464193-127464215 CAGGAGGGCCCCAGCTGCTGAGG - Intronic
1061987824 9:134140354-134140376 CAGGAGGCCCCCACCAGCTCTGG - Intronic
1062328069 9:136022277-136022299 CCCGAGGCCCACTGCATGTGGGG - Intronic
1062436958 9:136550645-136550667 CTCGAGGCCTACACCAGCTGGGG - Intergenic
1062696692 9:137879317-137879339 CTCGAGGGCCAGGGCAGCTGGGG + Intronic
1203471365 Un_GL000220v1:116622-116644 CGCGACGCCCGCCGCAGCTGGGG - Intergenic
1203479186 Un_GL000220v1:160594-160616 CGCGACGCCCGCCGCAGCTGGGG - Intergenic
1187547307 X:20266708-20266730 CCCGAGCCCCACGGCAGCGGCGG + Exonic
1190916364 X:54814116-54814138 CTCCAGGCCCATACCAGCTGTGG - Intronic
1195295615 X:103473533-103473555 CACTTGGGCCACAGCAACTGGGG - Intergenic
1198529621 X:137538496-137538518 CACGATGCTCACAGCAGTGGGGG - Intergenic
1200093155 X:153645045-153645067 CTCCAGGCCCACTGCAGCTGTGG - Intronic