ID: 1145024543

View in Genome Browser
Species Human (GRCh38)
Location 17:19458110-19458132
Sequence GACTCAGGCCTAGCAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145024543 Original CRISPR GACTCAGGCCTAGCAGGGGA AGG Intergenic
900487675 1:2931158-2931180 CACACAGGCCTGGGAGGGGACGG + Intergenic
900937171 1:5773727-5773749 GACTGAGGCCTAGGAAGGAAGGG + Intergenic
901083854 1:6598924-6598946 AACTGAGGCCTAGCTGGGGTTGG - Intronic
902678941 1:18029600-18029622 AACTCCTGCCTAGCAGGAGACGG - Intergenic
902822932 1:18954604-18954626 ATCTCAGGCCTGGCTGGGGAAGG - Intronic
903221846 1:21873668-21873690 GACTCTGGCCTGGCTGGGGCAGG + Intronic
903326767 1:22573304-22573326 AGCTCAGGCCTGGCACGGGAAGG - Intronic
904044696 1:27602545-27602567 GACCCAGACCCAGCAGGGGAAGG + Intronic
904460025 1:30671030-30671052 GACTCAGCCCCAGCACGGGGGGG + Intergenic
904587071 1:31586506-31586528 CACCCAGGCCCAGCATGGGAGGG - Intronic
904787323 1:32992685-32992707 GTCTCAGGGCTTGCAGGGAAGGG + Intergenic
905303579 1:37002349-37002371 GAGTCAGACCTTGCTGGGGATGG + Intronic
905548294 1:38817233-38817255 CACTGAGGCCTAGAGGGGGAAGG - Intergenic
907607120 1:55829142-55829164 GGCTCAGTCATAGCAGTGGAGGG - Intergenic
908668409 1:66518293-66518315 CACTGAGGCCTAGCAGAGGGTGG + Intergenic
913317347 1:117564220-117564242 GCCACATGCCTAGAAGGGGAAGG - Intergenic
915510280 1:156383163-156383185 GGCTGAGGCCTAGAAGGGGATGG + Intronic
916649350 1:166820268-166820290 GCCTCAGGCCTAAGATGGGAGGG + Intergenic
919920109 1:202162338-202162360 GACTGAGGCCTAGCAGTGGCTGG + Intergenic
920285319 1:204874654-204874676 GCCCCAGGCCTAGGTGGGGAGGG - Intronic
920647996 1:207817341-207817363 GACTCAGGCTCAGCTGAGGATGG - Intergenic
923542105 1:234895962-234895984 GACACTGGCCTGGCTGGGGACGG - Intergenic
1063201136 10:3785806-3785828 GCCTCGGGCATAGAAGGGGACGG - Intergenic
1065405551 10:25359414-25359436 TACTCAGGCCTGTCAGGGGTTGG - Intronic
1065408657 10:25397039-25397061 GACTCTGTCTTAGCAGGTGAGGG - Intronic
1066429953 10:35342111-35342133 GACTCATCCCAAGCAGCGGAGGG + Intronic
1068753767 10:60626874-60626896 GACTGAGGACCAGCTGGGGAGGG + Intronic
1070664820 10:78335669-78335691 GGATCAGGCCAAGGAGGGGAAGG + Intergenic
1070847935 10:79539151-79539173 GACTCAGGCCTAGGAGATAAGGG + Intergenic
1070925846 10:80220988-80221010 GACTCAGGCCTAGGAGATAAGGG - Intergenic
1073251308 10:102121518-102121540 AACCCAGCCCTAGGAGGGGAGGG + Intergenic
1074439391 10:113461570-113461592 GACTCTAGCCTAGCAGGGTGGGG + Intergenic
1075007144 10:118839342-118839364 GACTCAGACTTAGGAGGGCAGGG + Intergenic
1075064773 10:119282015-119282037 GACGCAGACCAAGGAGGGGAGGG - Intronic
1076334251 10:129694368-129694390 GTCTCAGCCCTCCCAGGGGAAGG - Intronic
1076368297 10:129936188-129936210 GACTGAGACCTTGCAGGTGAAGG - Intronic
1077090412 11:775825-775847 GCCTCTGTCCTACCAGGGGAAGG + Intronic
1077325602 11:1962667-1962689 GTCTCAGGCCTCGCAGGGTGCGG - Intronic
1080650076 11:34215246-34215268 CACTGATCCCTAGCAGGGGAAGG - Intronic
1081834832 11:46144819-46144841 GGCCCAGGCCTAGGAGGAGAGGG + Intergenic
1083275921 11:61597096-61597118 AACTCAGGCCAAGGAGAGGAAGG - Intergenic
1083306977 11:61766306-61766328 GACACTGGCCTGGCATGGGATGG + Intronic
1083421604 11:62556416-62556438 GACTCAGGCCTCCCTGGGGCAGG + Intergenic
1083682799 11:64359081-64359103 GACTCAGGCCGCGCAGGGCGGGG + Intergenic
1084860616 11:72015567-72015589 GACACAGGCCCAGCGGGAGAAGG - Exonic
1084966007 11:72744950-72744972 GCCCCAGGCAGAGCAGGGGAGGG + Intronic
1085328787 11:75629376-75629398 GACCCAGGCTTGGCAGGGGGTGG - Intronic
1086994891 11:93345015-93345037 CACTCAGGCCTATCAGAAGATGG - Intronic
1088613971 11:111604012-111604034 GGTTCAGGACCAGCAGGGGAAGG - Intronic
1089400311 11:118160632-118160654 AACTCAGGCCAAGCTGGGGAGGG + Intergenic
1091038336 11:132254012-132254034 AACTCAAGCCAAGCAGGGGCTGG + Intronic
1091303272 11:134521483-134521505 GACTCAGGCCTGGGTGGGGAAGG - Intergenic
1202808582 11_KI270721v1_random:17846-17868 GTCTCAGGCCTCGCAGGGTGCGG - Intergenic
1096229541 12:49889425-49889447 GCCTGAGGCTGAGCAGGGGAAGG - Intronic
1097192372 12:57225751-57225773 GGCTCAGGACTGGCTGGGGAGGG - Exonic
1097279047 12:57833262-57833284 GCCTCAGTCCTAGATGGGGAGGG + Intronic
1101180366 12:102210308-102210330 GACTCGGGACTACTAGGGGAGGG + Intergenic
1103722813 12:122983680-122983702 GACTCAGACCGAGCCAGGGAGGG + Exonic
1103997204 12:124838197-124838219 GAAGCTGGCCTGGCAGGGGATGG - Intronic
1104093813 12:125537987-125538009 GAAGCAGGCCTGGCTGGGGATGG - Intronic
1104280737 12:127374232-127374254 GAAGCAGGCCTGGCTGGGGATGG + Intergenic
1104942045 12:132399762-132399784 GACTCAGGCGTTGGAGGGGCTGG - Intergenic
1105805651 13:23950411-23950433 GACCCAGGCCTAGATGAGGAGGG - Intergenic
1108080147 13:46726840-46726862 GACACTGCTCTAGCAGGGGAAGG - Intronic
1109393055 13:61718577-61718599 CACTGGGGCCTATCAGGGGAGGG - Intergenic
1110324682 13:74200275-74200297 GATTCAGGCATACCAGAGGATGG + Intergenic
1113252714 13:108472152-108472174 GCCTCAGGCCTATGATGGGAGGG - Intergenic
1113511002 13:110854893-110854915 GACCCAGACCCAGCAGGGGGTGG - Intergenic
1114556865 14:23567236-23567258 GACTCAGGCCCAGGAGCGGGAGG - Exonic
1117165648 14:53029941-53029963 CACTGAGGCCTAGCAGAGGGTGG - Intergenic
1117995565 14:61474541-61474563 CACTGGGGCCTGGCAGGGGATGG + Intronic
1119773975 14:77237277-77237299 GGCACGGGCCTAGCAGGGGTGGG - Intronic
1121767163 14:96497832-96497854 GACTCAGGACAAGCAAGGCAAGG + Intergenic
1122077622 14:99246157-99246179 GACCCAGGCCGAGTGGGGGAGGG + Intronic
1123871690 15:24581511-24581533 GCATCAGGCCTAGGATGGGAGGG + Intergenic
1123879015 15:24657144-24657166 GTTTCAGGCCTGGCATGGGATGG + Intergenic
1123957533 15:25353731-25353753 GAACCAGTCTTAGCAGGGGATGG + Intronic
1124612822 15:31220235-31220257 GACACAGGCTGAGCGGGGGATGG - Intergenic
1124929502 15:34105501-34105523 TACTCAGCCCTGGCAGGGGATGG + Exonic
1125745356 15:41993940-41993962 AACTCAGGCCCAGCCGGGGTGGG - Intronic
1128552891 15:68609631-68609653 GGCTCAGGCCTGGCAGTGGAAGG - Intronic
1129250611 15:74306918-74306940 GACGGAGGCCCAGGAGGGGAGGG - Intronic
1130084154 15:80763258-80763280 TACTGGGGCCTACCAGGGGAGGG - Intergenic
1130150405 15:81307299-81307321 GCCTCAGGCCCAGAAGGGAAGGG - Intronic
1130377395 15:83341193-83341215 AACTGAGGCCCAGCAGGGGAAGG + Intergenic
1131354587 15:91733770-91733792 GACACAGAGCTAGCCGGGGAAGG - Intergenic
1132986266 16:2769208-2769230 GGGCCAGGCTTAGCAGGGGAAGG - Exonic
1133420054 16:5638386-5638408 CACACAGCCCTAGCAGGGGGAGG + Intergenic
1133553353 16:6881030-6881052 GCCACAGGCATAGGAGGGGAAGG - Intronic
1135275032 16:21104917-21104939 GACTCAGACCTAGCCTAGGAAGG - Intronic
1135741372 16:24978058-24978080 GACTCAGGGCTGGCAGGCAATGG + Intronic
1138289558 16:55835386-55835408 GACCCAGGCTTAGCATGGTAGGG + Intergenic
1138559072 16:57789201-57789223 GAGTCCGTCCGAGCAGGGGAAGG + Intronic
1139473988 16:67193335-67193357 GACTCAGGTCCACCGGGGGAGGG - Intronic
1139650238 16:68358778-68358800 ATCTAAGGCCTAGCAGGGGTGGG - Exonic
1141659934 16:85436363-85436385 GACTCAGGGCTAGGATGGGCTGG - Intergenic
1141917780 16:87111911-87111933 GAGAAAGGCCTAGAAGGGGAAGG - Intronic
1143078817 17:4366515-4366537 GACTCACGCCCGGAAGGGGAGGG + Intronic
1143323995 17:6086705-6086727 GATTCAGGCCCAGAAGTGGATGG + Intronic
1144841322 17:18188091-18188113 CACCCAGGCCTAACATGGGAAGG - Intronic
1145024543 17:19458110-19458132 GACTCAGGCCTAGCAGGGGAAGG + Intergenic
1145770923 17:27492525-27492547 AACTCAGCCCAAGCAAGGGAAGG - Intronic
1146944822 17:36866540-36866562 GACTCAGGCCTTTCAAGGCAGGG - Intergenic
1147319205 17:39635956-39635978 GCCGCAGCCCTAGCAGGCGAGGG - Exonic
1147942586 17:44059757-44059779 GACTCTGACCTAGCAGGAAATGG - Intronic
1150590474 17:66558126-66558148 GCCTCAAGCCTAGGAGGGCAAGG - Intronic
1151402791 17:73866852-73866874 GGTTCAGGCCTGGCAGGGCAGGG + Intergenic
1151656918 17:75500530-75500552 GAGGCAGGGCTAGCAGGGGTGGG - Exonic
1152082619 17:78197771-78197793 GACCCAGGACAAGCAGTGGAGGG + Intronic
1152188929 17:78876392-78876414 CACTCCAGCCTAGCAGGGGTGGG - Intronic
1152572753 17:81127720-81127742 GAGTCGGGCCGAGCAGGGGAGGG + Intronic
1152580862 17:81165132-81165154 CACTCAGGCCAAGCAGGGGCCGG + Intronic
1152753430 17:82077179-82077201 GCCTCAGGCCCTGCAGGGCAAGG - Intergenic
1153001045 18:455653-455675 CACCCAGGCCTGTCAGGGGAGGG - Intronic
1153943175 18:9994475-9994497 GACACAGGGGAAGCAGGGGAGGG + Intergenic
1155106046 18:22667358-22667380 GACACAGCCCAGGCAGGGGAGGG + Intergenic
1156955137 18:42953539-42953561 GACTCTGGCCTATTAGGGGCAGG + Intronic
1157047300 18:44117901-44117923 GAATCAGCACTAGCAGGAGATGG - Intergenic
1160788939 19:913809-913831 AACTGAGGCTAAGCAGGGGAAGG - Intergenic
1161008060 19:1946162-1946184 GTCTCAGGCCGCGCAGAGGAGGG + Intronic
1161149925 19:2702378-2702400 GGCTCAGGGCTAGCTGGGGAGGG - Intronic
1161590995 19:5129017-5129039 TGCTCAGGACTAGCAGGGGTGGG + Intronic
1161626632 19:5330763-5330785 GACTCCGGCCCTGCTGGGGAAGG - Intronic
1163875055 19:19860922-19860944 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1163875735 19:19866117-19866139 GACTGAGGCCGAGCTGGGCAGGG - Intronic
1163884858 19:19956536-19956558 GACTGAGGCCAAGCTGGGCAAGG + Intergenic
1163906261 19:20151663-20151685 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1163908348 19:20167475-20167497 GACTGAGGCCGAGCTGGGTAAGG - Intronic
1163938618 19:20473306-20473328 GACTGAGGCCGAGCTGGGTAAGG - Intergenic
1163948821 19:20565494-20565516 GACTGAGGCCGAGCTGGGCAAGG + Intronic
1164005230 19:21142308-21142330 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164026676 19:21359265-21359287 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164030288 19:21397390-21397412 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164226421 19:23250096-23250118 GACTGAGGCCCAGCTGGGCAAGG + Intronic
1164241719 19:23395181-23395203 GACTGAGGCCGAGCTGGGCAAGG + Intronic
1164254144 19:23512370-23512392 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1165755246 19:38289071-38289093 GACACAGGCCTAGCTGGGTCTGG - Intronic
1166213115 19:41319967-41319989 GAGTCAGGCTGGGCAGGGGAGGG - Intronic
1166855462 19:45780859-45780881 GCCCCAGGCCTGGCAGGGGAGGG + Intronic
1167769781 19:51507946-51507968 GACTAAGGCCTAGTGGGGGTGGG + Intergenic
925289782 2:2739751-2739773 GGCTCAGGCCTAGTAGTGTAGGG + Intergenic
925983889 2:9199419-9199441 AACTTAGATCTAGCAGGGGAAGG - Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926135000 2:10330375-10330397 GACTCAGGGCTTGGTGGGGAGGG - Intronic
927082486 2:19644173-19644195 GACTCCAGCCTAGCTGTGGAGGG + Intergenic
927206749 2:20615949-20615971 GACACAGGCCTGGCCAGGGAAGG + Intronic
927705896 2:25296421-25296443 GCATCAGGCATAGCAGGGAAAGG + Intronic
931817236 2:65916620-65916642 GCCACAGTTCTAGCAGGGGAAGG + Intergenic
932416819 2:71578620-71578642 GAGGCAGGCCTTGCAGGGGCTGG + Intronic
933737391 2:85505995-85506017 GAATCAGGCCCAGAAGGGAATGG - Intergenic
934614173 2:95761171-95761193 GACTCAGGGACAGCTGGGGAGGG - Intergenic
934646737 2:96063357-96063379 GACTCAGGGACAGCTGGGGAGGG + Intergenic
934840140 2:97619439-97619461 GACTCAGGGACAGCTGGGGAGGG + Intergenic
936784258 2:116074328-116074350 CACTGAGGCCTGTCAGGGGAGGG - Intergenic
939626501 2:144484044-144484066 TACACAGGCCAAGCAGGTGAGGG + Intronic
939741055 2:145906680-145906702 ATCTCAGGCCTAGTAGGAGAAGG - Intergenic
940276937 2:151949454-151949476 GAGTCAGGCCTTGAAGGAGATGG + Intronic
940349118 2:152661293-152661315 CACTCTGGCCTAGGAGTGGATGG + Intronic
942367544 2:175243609-175243631 GACTGAGGCAGAGCAGGTGAGGG - Intergenic
943559216 2:189441373-189441395 GTCTCAGGCCTAGAAGGGCCCGG + Intergenic
944541535 2:200758103-200758125 GAATCAGAATTAGCAGGGGATGG + Intergenic
945437517 2:209836765-209836787 GACACAGGGCCAGAAGGGGAGGG - Intronic
945809005 2:214525248-214525270 ACCTCAGGCCTGGCAGGTGAGGG + Intronic
1170431378 20:16279703-16279725 GCTTCAGGCCTAGCTGTGGATGG - Intronic
1170582404 20:17709340-17709362 CACTGAGGCCTAGCAGGCAAGGG + Intronic
1172109249 20:32535930-32535952 GACTCTGGCCTGGCGGGGGCAGG + Intronic
1172113342 20:32560137-32560159 GAGTCAGGCCTGGCAGGGCGTGG - Intronic
1172667866 20:36613369-36613391 GACTGTGGCCTAGAAGGGAAAGG - Exonic
1173246563 20:41341346-41341368 GTCTCAGGGCAAGCAGGGCAAGG - Intronic
1173844345 20:46178547-46178569 GACCTTGGCCTAGCTGGGGACGG - Intronic
1174046904 20:47740266-47740288 GACTCAAGCCTAGCAGAGGCGGG + Intronic
1174458950 20:50669437-50669459 GCCTCAGGCCTGAGAGGGGAAGG - Intronic
1176065793 20:63193916-63193938 GAGCCAGGCCTACCAGGGGAAGG - Intergenic
1176105451 20:63383801-63383823 GACTCAGGCCCAGCACTGCAAGG - Intergenic
1176152450 20:63598947-63598969 GAGGCAGGCCTAGGAGGGGCAGG - Intronic
1176302046 21:5103025-5103047 GAGACAGGCCTGGCGGGGGAGGG + Intergenic
1176429714 21:6568183-6568205 GTCCCAGGCCTAGCAGTGGGTGG - Intergenic
1179705108 21:43175645-43175667 GTCCCAGGCCTAGCAGTGGGTGG - Intergenic
1179731854 21:43372606-43372628 GACCCAGGCCTAGCCAGGGCGGG + Intergenic
1179854983 21:44158875-44158897 GAGACAGGCCTGGCGGGGGAGGG - Intergenic
1180057614 21:45367044-45367066 GACTCAGGCCCAGCTGGCGGGGG + Intergenic
1180953023 22:19729286-19729308 AACTCAGTCCAAGCAGGGCAGGG + Intergenic
1181392589 22:22594578-22594600 GAGTGAGGACGAGCAGGGGAGGG - Intergenic
1181483746 22:23217965-23217987 GAGTCAGGCCCTGCAGGGAAGGG + Intronic
1181631295 22:24152984-24153006 CACTCAGGCCTTGGAAGGGATGG + Intronic
1183734626 22:39636969-39636991 GACTGAGGCCTAGATGGGAAGGG + Intronic
950457594 3:13101926-13101948 GACTCTGGCCTTGCAGGGGTGGG + Intergenic
950717710 3:14861673-14861695 GCCTCAAGCCAAGCAGGGGGTGG - Intronic
951154583 3:19334193-19334215 GACTGAGGCCTAAGAGGTGATGG + Intronic
952904583 3:38131385-38131407 CTCTCAGCACTAGCAGGGGAGGG - Intronic
954327312 3:49870514-49870536 GACTCTGGCCTTGCAGGAGTTGG - Intergenic
954415966 3:50393488-50393510 AACTCAGGCCTAGGCTGGGATGG + Intronic
954921863 3:54198277-54198299 GAGTCAGGCCTTGCAGGCAATGG - Intronic
955367644 3:58325380-58325402 GGCTAAGGCCTAGCTGGGCATGG - Intergenic
957938009 3:86968910-86968932 GACTCAGACACAGCAGGGGGAGG + Exonic
961552634 3:127677849-127677871 GGCTCAGGCAGAGCTGGGGATGG + Intronic
962818476 3:139023008-139023030 TACTCAGGACTGGCAGGGCATGG - Intronic
962875560 3:139533694-139533716 GAATCAGGCCAAGTGGGGGAAGG + Intronic
962937440 3:140093550-140093572 GACTGAGGGCTAGCAGAGGGTGG + Intronic
963799011 3:149658408-149658430 GGCTCAGGCCTAGGAAGGGCCGG + Intronic
966613309 3:181889448-181889470 GACTGAGGCCCAGCAGGGCATGG - Intergenic
969121297 4:4913429-4913451 GACCCAGGCCAATCAGGGGGTGG - Intergenic
969275766 4:6134845-6134867 GCCTCAAGCCTAGCATGGGAGGG + Intronic
969782573 4:9420564-9420586 CACTAAGGCCTACCTGGGGATGG + Intergenic
970288742 4:14548932-14548954 CACTGGGGCCTATCAGGGGAGGG + Intergenic
972582168 4:40404604-40404626 GAGTAGGGCCTTGCAGGGGACGG - Intergenic
974421659 4:61683918-61683940 GACTCAGCTCTAGCAGGGCACGG - Intronic
978054221 4:104243313-104243335 CACTCAGGCCTACCTGAGGATGG - Intergenic
979758873 4:124374642-124374664 GCCTCCGGGCTGGCAGGGGATGG + Intergenic
984419818 4:179506881-179506903 GTCTCAGGGCTAGCAGAGGTGGG + Intergenic
984778495 4:183504602-183504624 GGCTCTGGGCTAGCGGGGGAGGG - Intergenic
985173773 4:187179103-187179125 GGCTCAGGACTAGGAGGAGATGG - Intergenic
985682533 5:1264083-1264105 GACTCACGCCCAGCAGGGCCCGG + Intronic
987115886 5:14726412-14726434 GAGGCAGGGCAAGCAGGGGAAGG + Intronic
991630857 5:68655290-68655312 GCTTCAGGCCTGGCTGGGGAAGG - Intergenic
992088380 5:73298025-73298047 CACTTAGGCCAAGCAGGCGATGG + Intergenic
994227381 5:97268530-97268552 CACTGAGGCCTATCAGAGGATGG - Intergenic
996016559 5:118545395-118545417 GATTGAAGCCTTGCAGGGGAGGG - Intergenic
997215110 5:132103612-132103634 AACTCATGCCTAGCTGGGCAGGG - Intergenic
997248386 5:132370373-132370395 GTCTCAGCCCCAGCAGGGGCCGG - Intronic
999196534 5:149785172-149785194 GACTGAGGCCCAGGAGGGGCTGG - Intronic
1000555800 5:162724443-162724465 CACTGGGGCCTAGCAGGGGATGG - Intergenic
1003099086 6:3163236-3163258 GGCTCAGGCCTTGCCGGCGACGG - Intergenic
1003154201 6:3577552-3577574 CCCTCAGGCCCTGCAGGGGAGGG - Intergenic
1006645772 6:35513005-35513027 GGCCTGGGCCTAGCAGGGGAGGG - Intergenic
1006718697 6:36136367-36136389 AACTGAGGCCCAGAAGGGGAAGG + Intronic
1006788263 6:36682329-36682351 AACTCATGCCTAGCAGAGGGTGG + Intronic
1007234231 6:40378868-40378890 GAGTCAGGCCTGGGAGGGGCCGG - Intergenic
1008082415 6:47208404-47208426 GCTTCAGGCCTGGCAGGGGCTGG - Intergenic
1009186887 6:60584832-60584854 CACTGAGGCCTGTCAGGGGATGG + Intergenic
1010285560 6:74073735-74073757 GATTCAGCCCTTTCAGGGGAAGG + Intergenic
1011014380 6:82738538-82738560 GACTCTAACCTAGAAGGGGAGGG - Intergenic
1011557764 6:88587707-88587729 GACTCAGACCCTGCAGGGGCAGG - Intergenic
1013770996 6:113628164-113628186 GCCTGAGGCCTCGGAGGGGATGG + Intergenic
1016200031 6:141395200-141395222 GGCTCAGCCAAAGCAGGGGACGG + Intergenic
1018429168 6:163709918-163709940 GACTGTGGCCAAGCAGGGAAGGG + Intergenic
1018859919 6:167704053-167704075 GACTCAGCCCTGGGAGGGGAGGG + Intergenic
1018928856 6:168226342-168226364 GACTCAGGCCTTCCAGGACAAGG + Intergenic
1019513674 7:1430405-1430427 GACTTGGGCTGAGCAGGGGAGGG - Intronic
1019710554 7:2516441-2516463 CACTCAGGCCTAGAGGGGAAGGG - Intronic
1020142584 7:5620716-5620738 GCCTCAACCCTGGCAGGGGAGGG - Intronic
1021983492 7:26077452-26077474 GTCTCATTCCTAACAGGGGAAGG + Intergenic
1023932257 7:44713073-44713095 GGCACAGCCCCAGCAGGGGAAGG - Intergenic
1024858264 7:53807132-53807154 AACTCAGTCCTAGCTGGGGAAGG + Intergenic
1026378581 7:69776330-69776352 GAACCAGGACTAGTAGGGGAAGG + Intronic
1029694375 7:102203342-102203364 GACCCTGGCTTGGCAGGGGAGGG - Intronic
1030676222 7:112388674-112388696 GACTCATGGTTACCAGGGGATGG + Intergenic
1032474574 7:132203291-132203313 GGCTGGGGCCTAGCAGGGGAGGG - Intronic
1034614197 7:152400870-152400892 GACTAAGGGAAAGCAGGGGAGGG + Intronic
1037886236 8:22597876-22597898 GACCCATGGCTAGCAGGGAAGGG + Intronic
1037912509 8:22752233-22752255 GGCTCAGGCTTATCAGGAGATGG + Intronic
1039233063 8:35470411-35470433 GATTATGGTCTAGCAGGGGAAGG + Intronic
1040511556 8:48100473-48100495 GGCTCAGCCCTAGCAGGATAGGG - Intergenic
1040753512 8:50740974-50740996 CACTGAGGCCTATCAGAGGACGG + Intronic
1041643672 8:60229554-60229576 GACTTAGGCCAGGGAGGGGATGG - Intronic
1042646495 8:70992820-70992842 GACTCAGACCTCTGAGGGGAAGG - Intergenic
1044392051 8:91662883-91662905 AACACAGGCCTTACAGGGGATGG - Intergenic
1048013034 8:130473803-130473825 GAGCCAGGCCTTGAAGGGGAAGG + Intergenic
1048996820 8:139799735-139799757 TACCCCGGCCTGGCAGGGGAAGG + Intronic
1049242223 8:141543822-141543844 GGCCCAGGCATGGCAGGGGAAGG - Intergenic
1049337793 8:142095805-142095827 GACCCAGCCTGAGCAGGGGATGG + Intergenic
1049731237 8:144179614-144179636 GACTCAGGCCTAGCTTGGGAAGG + Intronic
1051522962 9:18011444-18011466 CACTCATGCCTAGGAGAGGATGG + Intergenic
1057666884 9:97052973-97052995 GACTCCAGCCTTGCAGGGGAGGG + Intergenic
1060215284 9:121735293-121735315 GCCTAGGGCCCAGCAGGGGATGG + Intronic
1061091404 9:128428569-128428591 GACTAAGGCCCAACAGGGAAAGG - Intronic
1061236212 9:129344090-129344112 TGCTGAGGCCCAGCAGGGGAAGG + Intergenic
1061251917 9:129431388-129431410 GGCTCAGGCCCAGCTGGGGGCGG - Intergenic
1061576979 9:131513489-131513511 GACCCAGGCCTGGCCGCGGAAGG + Intronic
1062017707 9:134299586-134299608 GACTGAGGCCCAGAAAGGGATGG + Intergenic
1062044832 9:134420173-134420195 GAAGCAGGCCTGGCAGGGGCGGG - Intronic
1062052930 9:134456833-134456855 GATGCAGGCTGAGCAGGGGAAGG - Intergenic
1186182853 X:6989952-6989974 GACTCAGGGAAGGCAGGGGAAGG + Intergenic
1186774309 X:12848967-12848989 CACTCGGGCCTATCAGGGGGTGG - Intergenic
1187317217 X:18207062-18207084 GACCCTGGCCTAGCAGTGCAGGG + Intronic
1187886711 X:23895476-23895498 CACTGGGGCCTATCAGGGGATGG + Intronic
1187963194 X:24585655-24585677 CACTCTGGCCTGGCATGGGATGG - Intronic
1189247696 X:39576304-39576326 GGCACAGGCATGGCAGGGGAGGG - Intergenic
1191716669 X:64198380-64198402 TACTCAGGCCTGGTGGGGGATGG + Intronic
1195675347 X:107503403-107503425 AACTGAGGCCTAGGAAGGGAAGG + Intergenic
1197298007 X:124742922-124742944 TACTCCTGCCTAGAAGGGGAGGG - Intronic
1199233693 X:145467691-145467713 GTCCCAGGCCTAGCAGGGAGTGG - Intergenic
1199945840 X:152666265-152666287 GACACTGCTCTAGCAGGGGAAGG - Intergenic
1200116749 X:153772888-153772910 GACTCAGGCTCAGCAGGACAGGG - Exonic
1200236132 X:154468623-154468645 GGCTCGGGCCTGGCAGGGGTGGG - Intronic
1200960516 Y:8991902-8991924 GACCAATGCCTGGCAGGGGATGG - Intergenic