ID: 1145025825

View in Genome Browser
Species Human (GRCh38)
Location 17:19467173-19467195
Sequence GCCTGTACATAGTTTAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145025825_1145025829 15 Left 1145025825 17:19467173-19467195 CCCATCTTAAACTATGTACAGGC No data
Right 1145025829 17:19467211-19467233 ATTTAACTGGAGACCAAGTTAGG No data
1145025825_1145025828 2 Left 1145025825 17:19467173-19467195 CCCATCTTAAACTATGTACAGGC No data
Right 1145025828 17:19467198-19467220 CCAGAAGACAGTCATTTAACTGG No data
1145025825_1145025830 21 Left 1145025825 17:19467173-19467195 CCCATCTTAAACTATGTACAGGC No data
Right 1145025830 17:19467217-19467239 CTGGAGACCAAGTTAGGCTGTGG No data
1145025825_1145025832 26 Left 1145025825 17:19467173-19467195 CCCATCTTAAACTATGTACAGGC No data
Right 1145025832 17:19467222-19467244 GACCAAGTTAGGCTGTGGGTTGG No data
1145025825_1145025831 22 Left 1145025825 17:19467173-19467195 CCCATCTTAAACTATGTACAGGC No data
Right 1145025831 17:19467218-19467240 TGGAGACCAAGTTAGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145025825 Original CRISPR GCCTGTACATAGTTTAAGAT GGG (reversed) Intergenic
No off target data available for this crispr