ID: 1145026367

View in Genome Browser
Species Human (GRCh38)
Location 17:19470814-19470836
Sequence CTCACTCACCACAGTCGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145026361_1145026367 -9 Left 1145026361 17:19470800-19470822 CCGCATTCTTCCTCCTCACTCAC No data
Right 1145026367 17:19470814-19470836 CTCACTCACCACAGTCGTGGGGG No data
1145026358_1145026367 17 Left 1145026358 17:19470774-19470796 CCTGCCTCATTTTCCATCTCTCA No data
Right 1145026367 17:19470814-19470836 CTCACTCACCACAGTCGTGGGGG No data
1145026360_1145026367 4 Left 1145026360 17:19470787-19470809 CCATCTCTCAATTCCGCATTCTT No data
Right 1145026367 17:19470814-19470836 CTCACTCACCACAGTCGTGGGGG No data
1145026359_1145026367 13 Left 1145026359 17:19470778-19470800 CCTCATTTTCCATCTCTCAATTC No data
Right 1145026367 17:19470814-19470836 CTCACTCACCACAGTCGTGGGGG No data
1145026357_1145026367 23 Left 1145026357 17:19470768-19470790 CCAGTGCCTGCCTCATTTTCCAT No data
Right 1145026367 17:19470814-19470836 CTCACTCACCACAGTCGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145026367 Original CRISPR CTCACTCACCACAGTCGTGG GGG Intergenic