ID: 1145029628

View in Genome Browser
Species Human (GRCh38)
Location 17:19494991-19495013
Sequence GTCCAAGAGGCCCACCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145029628_1145029638 12 Left 1145029628 17:19494991-19495013 CCCTGCGGGTGGGCCTCTTGGAC No data
Right 1145029638 17:19495026-19495048 GGAGACAGCGCCACGGGTGTGGG No data
1145029628_1145029632 5 Left 1145029628 17:19494991-19495013 CCCTGCGGGTGGGCCTCTTGGAC No data
Right 1145029632 17:19495019-19495041 ACCCTCCGGAGACAGCGCCACGG No data
1145029628_1145029637 11 Left 1145029628 17:19494991-19495013 CCCTGCGGGTGGGCCTCTTGGAC No data
Right 1145029637 17:19495025-19495047 CGGAGACAGCGCCACGGGTGTGG No data
1145029628_1145029634 6 Left 1145029628 17:19494991-19495013 CCCTGCGGGTGGGCCTCTTGGAC No data
Right 1145029634 17:19495020-19495042 CCCTCCGGAGACAGCGCCACGGG No data
1145029628_1145029631 -9 Left 1145029628 17:19494991-19495013 CCCTGCGGGTGGGCCTCTTGGAC No data
Right 1145029631 17:19495005-19495027 CTCTTGGACGCAGCACCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145029628 Original CRISPR GTCCAAGAGGCCCACCCGCA GGG (reversed) Intergenic
No off target data available for this crispr