ID: 1145029631

View in Genome Browser
Species Human (GRCh38)
Location 17:19495005-19495027
Sequence CTCTTGGACGCAGCACCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145029629_1145029631 -10 Left 1145029629 17:19494992-19495014 CCTGCGGGTGGGCCTCTTGGACG No data
Right 1145029631 17:19495005-19495027 CTCTTGGACGCAGCACCCTCCGG No data
1145029628_1145029631 -9 Left 1145029628 17:19494991-19495013 CCCTGCGGGTGGGCCTCTTGGAC No data
Right 1145029631 17:19495005-19495027 CTCTTGGACGCAGCACCCTCCGG No data
1145029621_1145029631 26 Left 1145029621 17:19494956-19494978 CCTTCTCGTGCTTGGATTCGCGC No data
Right 1145029631 17:19495005-19495027 CTCTTGGACGCAGCACCCTCCGG No data
1145029620_1145029631 27 Left 1145029620 17:19494955-19494977 CCCTTCTCGTGCTTGGATTCGCG No data
Right 1145029631 17:19495005-19495027 CTCTTGGACGCAGCACCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145029631 Original CRISPR CTCTTGGACGCAGCACCCTC CGG Intergenic
No off target data available for this crispr