ID: 1145029637

View in Genome Browser
Species Human (GRCh38)
Location 17:19495025-19495047
Sequence CGGAGACAGCGCCACGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145029628_1145029637 11 Left 1145029628 17:19494991-19495013 CCCTGCGGGTGGGCCTCTTGGAC No data
Right 1145029637 17:19495025-19495047 CGGAGACAGCGCCACGGGTGTGG No data
1145029629_1145029637 10 Left 1145029629 17:19494992-19495014 CCTGCGGGTGGGCCTCTTGGACG No data
Right 1145029637 17:19495025-19495047 CGGAGACAGCGCCACGGGTGTGG No data
1145029630_1145029637 -2 Left 1145029630 17:19495004-19495026 CCTCTTGGACGCAGCACCCTCCG No data
Right 1145029637 17:19495025-19495047 CGGAGACAGCGCCACGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145029637 Original CRISPR CGGAGACAGCGCCACGGGTG TGG Intergenic
No off target data available for this crispr