ID: 1145030527

View in Genome Browser
Species Human (GRCh38)
Location 17:19501571-19501593
Sequence ACTTGAAAACTGAACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145030527_1145030530 2 Left 1145030527 17:19501571-19501593 CCTTCAGGGTTCAGTTTTCAAGT 0: 1
1: 0
2: 0
3: 11
4: 203
Right 1145030530 17:19501596-19501618 TGGTTGGAATTTGTCAGATCAGG 0: 1
1: 0
2: 1
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145030527 Original CRISPR ACTTGAAAACTGAACCCTGA AGG (reversed) Intronic
900819202 1:4873300-4873322 ACCTGAAGACTGAACACTGCAGG - Intergenic
900894524 1:5474021-5474043 CATTGAAATCTGAACCCCGAGGG + Intergenic
903368383 1:22818752-22818774 ACGTCAAAACTGAGACCTGACGG - Intronic
907605426 1:55812586-55812608 AGTTGAAAAATGAAACCTCAAGG + Intergenic
909899794 1:81118623-81118645 AAATGCAAACTGAACCATGAAGG - Intergenic
910045675 1:82911312-82911334 ACTTGAACACTGAAATCTGCAGG - Intergenic
910081074 1:83342373-83342395 ATTTGAAAACTTACCCCTAAGGG + Intergenic
912242233 1:107923348-107923370 AGTTGAAATCCTAACCCTGAAGG + Intronic
912270809 1:108207344-108207366 TCCTGAAAACTGCACACTGATGG + Intergenic
912940334 1:114039271-114039293 ACTTCCAAACTGACACCTGAAGG + Intergenic
917091036 1:171353526-171353548 ACTTTTAAAGTGAGCCCTGAAGG - Intergenic
918990095 1:191686556-191686578 ACCTGAATTCTGATCCCTGATGG + Intergenic
922026109 1:221750637-221750659 AATTGCAAACTGAAGCATGAAGG - Intergenic
922074842 1:222233446-222233468 CCTTGAAAACTGAATTCTCACGG + Intergenic
922922413 1:229317541-229317563 ACTTGAACCCAGAACCCAGAAGG - Intergenic
924177076 1:241402081-241402103 TCTTGAAATCTGGACCCTAACGG + Intergenic
1064166190 10:12988292-12988314 ACTTTTAAACTGAAATCTGAAGG - Intronic
1066316493 10:34252435-34252457 ACAGGCAAACTTAACCCTGATGG + Intronic
1066410587 10:35164966-35164988 ACTTGAAACTTGAACCCGGAAGG + Intronic
1070293588 10:75139647-75139669 ATTTGAAAACTAATCCCTAAAGG - Intronic
1071237344 10:83664429-83664451 ACCTGAAAACTGAATCCTGGAGG + Intergenic
1072484579 10:95842962-95842984 ATATGAAAACTCAACCCTCAAGG + Intronic
1075864528 10:125706157-125706179 ACTAGAGCACTGAACCCTGTAGG + Intergenic
1077393527 11:2310447-2310469 CCCTGAGAACTGACCCCTGAAGG - Intronic
1077779490 11:5310060-5310082 AACTGAAAACTGAACCCAGGAGG + Intronic
1078153328 11:8777302-8777324 ACTTGTAAGCTCAACCCAGAGGG + Intronic
1078811476 11:14771044-14771066 ACCAGAAAACTTAAGCCTGAAGG + Intronic
1079111352 11:17606861-17606883 ACTCGATAACTGACCGCTGAAGG - Intronic
1079955697 11:26861903-26861925 ACTTTTAAACTAAACCTTGAAGG - Intergenic
1080077433 11:28167541-28167563 ACTGGAATACTGAATCCTGGAGG - Intronic
1081464953 11:43307823-43307845 CCTTTAAAACTGACCCTTGAGGG - Intergenic
1081949080 11:47027278-47027300 ACTTCAAAACTCATTCCTGAAGG - Intronic
1085907876 11:80786411-80786433 ACTAGAAAACTGAACCTGAAGGG + Intergenic
1086372334 11:86167784-86167806 ACCTGAAAACTTGACTCTGATGG + Intergenic
1087407733 11:97751439-97751461 GCTGGAAAAGTGACCCCTGAAGG - Intergenic
1090081361 11:123615087-123615109 ACTTGAAACTGAAACCCTGAAGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1091569928 12:1675845-1675867 AGAAGAAAACTGAACCCAGAAGG - Intergenic
1093532879 12:20187989-20188011 ACTTGAAGAGTGAACATTGAGGG - Intergenic
1095364604 12:41387500-41387522 GCTTGAACGCTGAACCCAGAAGG + Intronic
1095613894 12:44165547-44165569 AAATGAAAACTAAACACTGACGG + Intronic
1096030745 12:48412224-48412246 ACTTGTAAATTGAAACCAGATGG + Intergenic
1098769922 12:74539418-74539440 GTTTGAAAACTGAGCCCAGAGGG + Exonic
1099908089 12:88795730-88795752 ACATTAAAACTGAAACCTAAAGG - Intergenic
1101838433 12:108311096-108311118 AGTTGAAAGCAGGACCCTGATGG - Intronic
1102618519 12:114175432-114175454 ACACCAAGACTGAACCCTGAAGG + Intergenic
1104436240 12:128758893-128758915 CCTTGAAAACTTTAACCTGAGGG - Intergenic
1105026301 12:132851553-132851575 CTTTGAAACCTGACCCCTGAAGG + Intronic
1106569752 13:30916057-30916079 ATTTAAAACCTGACCCCTGATGG - Intronic
1108457930 13:50635194-50635216 ATATGAAAACTGAACTCAGAAGG - Intronic
1111491942 13:88990231-88990253 ACTGGAAACCTGAAGTCTGAAGG + Intergenic
1121485214 14:94309607-94309629 ACAGGAAAACTGAGCCCTGGAGG + Intronic
1123473561 15:20571626-20571648 ACTTGAAAAATGCCACCTGAGGG - Intergenic
1123644448 15:22428727-22428749 ACTTGAAAAATGCCACCTGAGGG + Intergenic
1123665764 15:22608635-22608657 ACTTGAAAAATGCCACCTGAGGG + Intergenic
1123733859 15:23166637-23166659 ACTTGAAAAATGCCACCTGAGGG - Intergenic
1123751996 15:23364018-23364040 ACTTGAAAAATGCCACCTGAGGG - Intronic
1124284362 15:28387942-28387964 ACTTGAAAAATGCCACCTGAGGG - Intronic
1124298335 15:28523672-28523694 ACTTGAAAAATGCCACCTGAGGG + Intronic
1124482925 15:30092382-30092404 ACTTGAAAAATGCCACCTGAGGG - Intronic
1124489378 15:30144453-30144475 ACTTGAAAAATGCCACCTGAGGG - Intronic
1124520651 15:30404836-30404858 ACTTGAAAAATGCCACCTGAGGG + Intronic
1124538006 15:30561383-30561405 ACTTGAAAAATGCCACCTGAGGG - Intronic
1124544466 15:30613444-30613466 ACTTGAAAAATGCCACCTGAGGG - Intronic
1124564429 15:30800879-30800901 ACTTGAAAAATGCCACCTGAGGG - Intergenic
1124754151 15:32393874-32393896 ACTTGAAAAATGCCACCTGAGGG + Intronic
1124760643 15:32446202-32446224 ACTTGAAAAATGCCACCTGAGGG + Intronic
1124777988 15:32602860-32602882 ACTTGAAAAATGCCACCTGAGGG - Intronic
1124887449 15:33700432-33700454 ACTTGAAAACTGAAGTTTCACGG + Intronic
1128775202 15:70315146-70315168 ACATGAAAACAGAAATCTGAAGG - Intergenic
1129686310 15:77688025-77688047 AGCTGAAAACTGAACCAGGATGG - Intronic
1130187225 15:81695722-81695744 ACTTGAACCCTGAACCCAGGAGG + Intergenic
1130375633 15:83326386-83326408 TCTGGAAGCCTGAACCCTGAAGG + Intergenic
1131325144 15:91436153-91436175 CCTTTAGAAATGAACCCTGAAGG + Intergenic
1131532656 15:93206878-93206900 ACTTCAAAACAGAAAACTGAAGG - Intergenic
1131780081 15:95846489-95846511 CCCTGAAAACTGAAACCTAAGGG - Intergenic
1132184507 15:99791890-99791912 AGTTGAAAAATGCAACCTGAGGG - Intergenic
1132432468 15:101772769-101772791 AGTTGAAAAATGCAACCTGAGGG + Intergenic
1133675502 16:8067255-8067277 ACTGGAAAACAGATGCCTGAAGG - Intergenic
1134660972 16:15984244-15984266 ACTTAAAAACTGGACCTTGGAGG - Intronic
1137500565 16:49008416-49008438 ACCTGAAACATGAATCCTGAAGG + Intergenic
1139322111 16:66123137-66123159 ACTTGAACCCTGAACCCAGGAGG + Intergenic
1139846110 16:69922725-69922747 ACTTGAAAAATAAAGCCAGAAGG - Intronic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1144347260 17:14360402-14360424 GCTTGAACCCTGAACCCGGAAGG - Intergenic
1145030527 17:19501571-19501593 ACTTGAAAACTGAACCCTGAAGG - Intronic
1146417074 17:32644826-32644848 TCTTGAATACAGTACCCTGATGG + Intronic
1147813288 17:43189181-43189203 AATAGAAAACTGAACCCAGGTGG + Intronic
1152683480 17:81682323-81682345 ACTTGAACCCTGAACCCTGGAGG - Intronic
1153773375 18:8433025-8433047 AGCTGAGGACTGAACCCTGACGG - Intergenic
1153912022 18:9712751-9712773 ACTTAAAAACTGCTTCCTGATGG + Intronic
1156692878 18:39729494-39729516 ATTAGGAAAATGAACCCTGAAGG - Intergenic
1157886226 18:51369484-51369506 TTTTGAAAAAAGAACCCTGATGG - Intergenic
1157992880 18:52518705-52518727 ACTTGCAAAGTGAACAGTGATGG + Intronic
1158186476 18:54777393-54777415 ACTTGAAAACTGATCCTTAGAGG + Intronic
1159446641 18:68548989-68549011 ACTTCAACACTCAACACTGATGG + Intergenic
1159695750 18:71554070-71554092 TCATGAAAACAGATCCCTGATGG + Intergenic
1160246687 18:77165281-77165303 ACTTGGACACGCAACCCTGAAGG - Intergenic
1160984493 19:1832028-1832050 ACTTGAACAAAGGACCCTGAGGG + Intronic
1162967655 19:14163655-14163677 CCTGGAAATGTGAACCCTGAAGG + Intronic
1163626679 19:18394137-18394159 ACTTGAAAGCTGAGGCCTGAGGG - Intronic
1167566067 19:50257885-50257907 ACGTGATGACTGAGCCCTGAAGG + Intronic
1167816725 19:51888688-51888710 ACTTGAAATCAAAACTCTGAAGG + Intronic
1167982675 19:53288440-53288462 TCTTGAAATGTGAACCCTGAGGG + Intergenic
1168494020 19:56835481-56835503 ACATTAAAGCTGAGCCCTGAAGG - Intronic
928243076 2:29603479-29603501 ACATGAAAACAGAGACCTGAAGG - Intronic
929571003 2:43022868-43022890 TCTTGAAAACTGATGCTTGAAGG - Intergenic
930969286 2:57375139-57375161 AGTAGAAAAGTGATCCCTGATGG + Intergenic
932132718 2:69202141-69202163 AGTTAAGCACTGAACCCTGAGGG + Intronic
935446465 2:103161825-103161847 ACTTTACAACTGCACACTGAAGG - Intergenic
937016634 2:118611758-118611780 ACTTGAACCCTGAAGCCTGCAGG - Intergenic
939353847 2:141075504-141075526 TCCTGAAAACTGATTCCTGAAGG - Intronic
939531543 2:143369087-143369109 TCATGCAAAATGAACCCTGATGG + Intronic
943591134 2:189798253-189798275 AGTAAAAAACTGAACCCAGAGGG - Intronic
944068158 2:195641225-195641247 ATTTATAAACTGAATCCTGAAGG + Intronic
945972818 2:216246811-216246833 AATTGAAAACTGAAATCTGCAGG - Intergenic
946316716 2:218920434-218920456 ACTTGAGATATGAATCCTGAAGG + Intergenic
1169595821 20:7197082-7197104 AATTGAAATCAGAATCCTGAAGG - Intergenic
1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG + Intronic
1172341951 20:34165352-34165374 ACTTTGAAACTGAAACCTGAAGG + Intergenic
1173112271 20:40203161-40203183 ACTTTACAACTAAAACCTGATGG + Intergenic
1174405879 20:50303070-50303092 ACATGTAAACTGAATCCTGAAGG + Intergenic
1177970322 21:27780614-27780636 AATTGACAACTTAACACTGATGG - Intergenic
1178222107 21:30671512-30671534 ACATGAAAACAGATCCCTGTGGG + Intergenic
1183620704 22:38970619-38970641 ACTTGGGAACTGAATCCTGAGGG - Intronic
951442301 3:22737350-22737372 ACTTTTGAATTGAACCCTGAAGG + Intergenic
952508116 3:34026224-34026246 ACTTGAAAACTGTTCCTTGGTGG + Intergenic
953726871 3:45407246-45407268 ACTGGCAAACTGAAAACTGATGG - Intronic
954406260 3:50346753-50346775 AGGTGTAAACTGAGCCCTGAAGG - Exonic
959314583 3:104786701-104786723 TCTTGAAATCTGAAAGCTGATGG - Intergenic
960891866 3:122457606-122457628 ACCTGAAATCTGCACACTGAAGG + Intronic
963715702 3:148801236-148801258 AGTTGAATATTGACCCCTGAGGG - Intronic
964913114 3:161805926-161805948 ACTTAAAAACTCAACCTTTATGG + Intergenic
965852335 3:173043189-173043211 ACTGGAAAACAGAAGCATGATGG - Intronic
967233418 3:187362829-187362851 ATATGAAAAGTGATCCCTGAGGG + Intergenic
970313314 4:14805411-14805433 AATTTAAAACTGGACCCTGGGGG - Intergenic
970769920 4:19599784-19599806 ACTTCAAAACTGAACCTTCTAGG - Intergenic
970951470 4:21761274-21761296 ACTTCTAAATTGAACCCTGGTGG + Intronic
973868941 4:55144942-55144964 ATTTGAGAAATGAAACCTGAAGG - Intergenic
976683834 4:87788314-87788336 ACTTCAGAACTGAGTCCTGAAGG + Intergenic
978543289 4:109842298-109842320 ACTTGAAAAAAGAACATTGAAGG + Intronic
978649436 4:110982580-110982602 ATTTCAAAACTTAACCCTGAAGG + Intergenic
981665191 4:147216198-147216220 ATTTGAAAAGTGAGCCCTGGAGG - Intergenic
984386049 4:179059686-179059708 ACATGAAAGCTGAACTGTGAGGG - Intergenic
985608047 5:869291-869313 ACTTTAAAACAGAAATCTGAAGG + Intronic
985653436 5:1117773-1117795 CCTTAAAAACTGATCCCTGCCGG + Intergenic
986746189 5:10747319-10747341 ACTGGAAATCTGAACCTTTAAGG + Intronic
987742827 5:21931950-21931972 ACTTGAAAGGTGGACCCTGGGGG + Intronic
988670520 5:33376297-33376319 GCTTGAAAATTAGACCCTGATGG - Intergenic
990849589 5:60187714-60187736 AGTTGAAAACTGACTGCTGATGG + Intronic
992528495 5:77633447-77633469 ACTTGAAAACTAGAGCATGACGG + Intronic
992930529 5:81639146-81639168 ATTTAAAAACTCAACCCTTAAGG - Intronic
993419771 5:87685873-87685895 ACTTGAACTCTGAACCCGGGAGG + Intergenic
997353909 5:133250012-133250034 CCTTTAAAACTGACCCCAGATGG - Intronic
997869542 5:137495412-137495434 ACTTGGAAACTGAAAACTAAGGG - Intronic
998128351 5:139638770-139638792 AATGCAAAACTGAATCCTGAGGG + Intergenic
998218745 5:140257915-140257937 ACTTGAGAACTCAGCTCTGAAGG + Intronic
1000310245 5:160036385-160036407 AAATGAAAACTGAACATTGAGGG + Intronic
1000517057 5:162250629-162250651 AAAGGAAAACTGAACCCTAAAGG + Intergenic
1000672691 5:164081745-164081767 TCTTGAAAACTAAACTCAGAAGG + Intergenic
1002457242 5:179352351-179352373 ACTTTAGAACCAAACCCTGACGG + Intergenic
1002549444 5:179976202-179976224 ACTGGAAAAGTCAACACTGAAGG + Intronic
1003375204 6:5570505-5570527 ACTGGAAATCTGAACCATGCAGG - Intronic
1004736876 6:18415555-18415577 ACGTTAAAACTGAACCCCCACGG - Intronic
1006654198 6:35576339-35576361 ACTTGAAAAAAAAATCCTGATGG + Intronic
1009025233 6:57991664-57991686 ACATTTAAACTGAAACCTGAGGG - Intergenic
1009810663 6:68660647-68660669 ACTTGTAAAGTAAACCATGATGG + Intronic
1010621387 6:78080669-78080691 AGTTCAAAACTAAACCCTGTAGG + Intergenic
1012220222 6:96639870-96639892 TCCTGAATACAGAACCCTGATGG - Intergenic
1013857690 6:114594178-114594200 ACATGTAAACTAAACTCTGAGGG - Intergenic
1014009996 6:116464613-116464635 TTTTGAAAACTGAATCCTGTAGG + Intergenic
1015694414 6:135964403-135964425 ACTTTAAAAATGAACCCAGAGGG - Intronic
1015751447 6:136564027-136564049 ATTTGAAAACTGAAGCCTGGAGG - Intronic
1016578157 6:145595156-145595178 ACTTGAAAACTAAAGCCAGTGGG - Intronic
1024838090 7:53548254-53548276 ACTTGATAACTAAAACCTAATGG + Intergenic
1026138158 7:67681659-67681681 ACCTGCAAAATGAACCATGAAGG - Intergenic
1027298548 7:76804634-76804656 ATTTGAAAACTTACCCCTAAGGG + Intergenic
1027877731 7:83792209-83792231 TCTTGCAAACTGAATCCTGGTGG + Intergenic
1029061053 7:97798234-97798256 ACTTGGACATTGAACCCTGGCGG - Intergenic
1030195203 7:106846475-106846497 TGTTGAAATCTGAACCCCGAAGG + Intergenic
1030339630 7:108362351-108362373 TGTTGAAATCTGAACCCTCAGGG - Intronic
1032026914 7:128450327-128450349 ACAAGAAAACTGAACCCAAAAGG - Intergenic
1034029010 7:147739373-147739395 ATTAGAAAACTGATACCTGAAGG - Intronic
1035237204 7:157506274-157506296 GCTGGAATACTGAAGCCTGAAGG + Intergenic
1036591582 8:10173488-10173510 CCGTGAATCCTGAACCCTGAAGG + Intronic
1036732670 8:11280091-11280113 ATTTGAAAACAGGACCTTGAAGG - Intergenic
1036927274 8:12919283-12919305 GCTTGAACCCTGAACCCAGAAGG + Intergenic
1039010390 8:33087030-33087052 ACTTTATAGCTGAACACTGAGGG + Intergenic
1039162756 8:34640529-34640551 TCCTGAAAACTGAAGTCTGAGGG - Intergenic
1039662386 8:39481477-39481499 ACCTGAACAGTGCACCCTGAAGG + Intergenic
1041131215 8:54703486-54703508 AATGGAAAAATGAAGCCTGAAGG - Intergenic
1043441257 8:80278925-80278947 ACTTGAAGAGGGAAGCCTGAAGG + Intergenic
1043497643 8:80820450-80820472 ACTTTAAAACTCAACCAAGAGGG - Intronic
1043912201 8:85875988-85876010 ACTGGATTACTGAACACTGAAGG - Intergenic
1046849174 8:118952958-118952980 ACTTGAACACTTGGCCCTGATGG - Intergenic
1048114951 8:131510760-131510782 ACATTTAAACTGAAGCCTGAAGG - Intergenic
1050357659 9:4798248-4798270 ACTGTTAAACTGAACCCTGCAGG - Intronic
1051746842 9:20303225-20303247 ACATTAAAAAAGAACCCTGAGGG + Intergenic
1053413050 9:37928154-37928176 ACTTGAGAACTCAGCACTGAAGG - Intronic
1055762364 9:79622456-79622478 ACCTGACAACTGAGACCTGAAGG - Intronic
1056293674 9:85169835-85169857 AGTTGAAAATGGACCCCTGATGG - Intergenic
1056478324 9:86974859-86974881 ACTTCTAAACTGAAGCATGAGGG - Intergenic
1057959871 9:99444815-99444837 ACATGAAAGCTGAGACCTGATGG - Intergenic
1058596365 9:106620275-106620297 ACCTGAGATCTGAACCCAGATGG + Intergenic
1060370926 9:123070256-123070278 CCTTGAATACAGAACCCTGGAGG - Intronic
1062164645 9:135101483-135101505 AATTGGAAACTGAAAACTGATGG - Intronic
1186160458 X:6771920-6771942 ACTAGAAAACTACAGCCTGAGGG - Intergenic
1187224679 X:17363874-17363896 TCTCCAAAAGTGAACCCTGAGGG + Intergenic
1187259821 X:17674755-17674777 ACTTGAAAACTCAAGTCTGGAGG - Intronic
1187585147 X:20652231-20652253 ACTAGAAAACTGTAACCTTAGGG + Intergenic
1187993813 X:24904447-24904469 ACTTGAAGACTGATGCATGAGGG - Intronic
1188403792 X:29781678-29781700 ACTTGAAAACTGACTGCTGCTGG + Intronic
1190555056 X:51625350-51625372 TCCTGAATACTGTACCCTGATGG - Intergenic
1192234909 X:69289624-69289646 ACCTGAAAACTGAACCAAGCTGG - Intergenic
1199897023 X:152136101-152136123 GCTTGCAGCCTGAACCCTGAGGG - Intronic