ID: 1145031293

View in Genome Browser
Species Human (GRCh38)
Location 17:19507277-19507299
Sequence GGAGGGCGACGCCCACGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145031293_1145031300 4 Left 1145031293 17:19507277-19507299 CCTGGCCGTGGGCGTCGCCCTCC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1145031300 17:19507304-19507326 CCCCGCGCTTGTCCCCTGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 84
1145031293_1145031303 9 Left 1145031293 17:19507277-19507299 CCTGGCCGTGGGCGTCGCCCTCC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1145031303 17:19507309-19507331 CGCTTGTCCCCTGAGAGGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 152
1145031293_1145031305 16 Left 1145031293 17:19507277-19507299 CCTGGCCGTGGGCGTCGCCCTCC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1145031305 17:19507316-19507338 CCCCTGAGAGGAGAGGAGAAAGG 0: 1
1: 1
2: 4
3: 55
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145031293 Original CRISPR GGAGGGCGACGCCCACGGCC AGG (reversed) Intronic