ID: 1145032427

View in Genome Browser
Species Human (GRCh38)
Location 17:19515058-19515080
Sequence AATTATCTGCGCACGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15392
Summary {0: 1, 1: 2, 2: 57, 3: 1385, 4: 13947}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145032427_1145032431 14 Left 1145032427 17:19515058-19515080 CCTGCCATCGTGCGCAGATAATT 0: 1
1: 2
2: 57
3: 1385
4: 13947
Right 1145032431 17:19515095-19515117 GAGACAGGGTTTCACCATGTTGG 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
1145032427_1145032430 0 Left 1145032427 17:19515058-19515080 CCTGCCATCGTGCGCAGATAATT 0: 1
1: 2
2: 57
3: 1385
4: 13947
Right 1145032430 17:19515081-19515103 TTTGTATTTTTGTAGAGACAGGG 0: 758
1: 4058
2: 10105
3: 21512
4: 66638
1145032427_1145032432 19 Left 1145032427 17:19515058-19515080 CCTGCCATCGTGCGCAGATAATT 0: 1
1: 2
2: 57
3: 1385
4: 13947
Right 1145032432 17:19515100-19515122 AGGGTTTCACCATGTTGGCCAGG 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
1145032427_1145032429 -1 Left 1145032427 17:19515058-19515080 CCTGCCATCGTGCGCAGATAATT 0: 1
1: 2
2: 57
3: 1385
4: 13947
Right 1145032429 17:19515080-19515102 TTTTGTATTTTTGTAGAGACAGG 0: 1320
1: 7530
2: 11990
3: 22010
4: 76216
1145032427_1145032433 23 Left 1145032427 17:19515058-19515080 CCTGCCATCGTGCGCAGATAATT 0: 1
1: 2
2: 57
3: 1385
4: 13947
Right 1145032433 17:19515104-19515126 TTTCACCATGTTGGCCAGGCTGG 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145032427 Original CRISPR AATTATCTGCGCACGATGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr