ID: 1145032562

View in Genome Browser
Species Human (GRCh38)
Location 17:19516058-19516080
Sequence CTTAGGAAGGCCAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118037
Summary {0: 2, 1: 70, 2: 2428, 3: 29389, 4: 86148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145032554_1145032562 -7 Left 1145032554 17:19516042-19516064 CCTATAATCCCAATGCCTTAGGA 0: 1
1: 8
2: 155
3: 1742
4: 15232
Right 1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG 0: 2
1: 70
2: 2428
3: 29389
4: 86148
1145032551_1145032562 25 Left 1145032551 17:19516010-19516032 CCACTTTTAGGGGCTGGATACAG 0: 1
1: 0
2: 1
3: 9
4: 153
Right 1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG 0: 2
1: 70
2: 2428
3: 29389
4: 86148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145032562 Original CRISPR CTTAGGAAGGCCAAGGTGGA GGG Intronic
Too many off-targets to display for this crispr