ID: 1145032562 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:19516058-19516080 |
| Sequence | CTTAGGAAGGCCAAGGTGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 118037 | |||
| Summary | {0: 2, 1: 70, 2: 2428, 3: 29389, 4: 86148} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1145032554_1145032562 | -7 | Left | 1145032554 | 17:19516042-19516064 | CCTATAATCCCAATGCCTTAGGA | 0: 1 1: 8 2: 155 3: 1742 4: 15232 |
||
| Right | 1145032562 | 17:19516058-19516080 | CTTAGGAAGGCCAAGGTGGAGGG | 0: 2 1: 70 2: 2428 3: 29389 4: 86148 |
||||
| 1145032551_1145032562 | 25 | Left | 1145032551 | 17:19516010-19516032 | CCACTTTTAGGGGCTGGATACAG | 0: 1 1: 0 2: 1 3: 9 4: 153 |
||
| Right | 1145032562 | 17:19516058-19516080 | CTTAGGAAGGCCAAGGTGGAGGG | 0: 2 1: 70 2: 2428 3: 29389 4: 86148 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1145032562 | Original CRISPR | CTTAGGAAGGCCAAGGTGGA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||