ID: 1145036096

View in Genome Browser
Species Human (GRCh38)
Location 17:19541618-19541640
Sequence CGTCCACTTGGAGTCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145036096_1145036103 25 Left 1145036096 17:19541618-19541640 CCCGCTGGGACTCCAAGTGGACG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1145036103 17:19541666-19541688 CTGTCTACAGACTTCCTTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145036096 Original CRISPR CGTCCACTTGGAGTCCCAGC GGG (reversed) Intronic
900788686 1:4665816-4665838 CCTCCACTTGGAGTTCCTGTAGG - Intronic
903861523 1:26367605-26367627 CGTCCTCTTGGAGGCCCTGCAGG + Exonic
907939530 1:59074030-59074052 CGGGCACCTGTAGTCCCAGCTGG + Intergenic
912087393 1:106026349-106026371 CGTCCCCTTGGGGTTTCAGCTGG - Intergenic
913189432 1:116400934-116400956 AGTCCACTCGGAGGCCCAACAGG - Exonic
918058977 1:181045879-181045901 CGCCCACTTGGAACTCCAGCTGG - Intronic
923951026 1:238954081-238954103 CGTGCACCTGTAGTTCCAGCTGG + Intergenic
924688223 1:246318254-246318276 CACACACTTGTAGTCCCAGCTGG + Intronic
1064028383 10:11867492-11867514 CGCACACCTGTAGTCCCAGCTGG + Intronic
1065768965 10:29059041-29059063 CGTACACCTGTAGTCCCAGGAGG + Intergenic
1069253977 10:66309558-66309580 CGGGCACCTGTAGTCCCAGCTGG + Intronic
1072016246 10:91349639-91349661 CTTCTTCTTGGGGTCCCAGCTGG + Intergenic
1072486295 10:95859046-95859068 CTTCCACTTTCAGTCCCAACAGG - Intronic
1074650208 10:115513885-115513907 TTTGTACTTGGAGTCCCAGCTGG - Intronic
1076401080 10:130185770-130185792 CGTCCACCTGGAGTGCGGGCTGG + Intergenic
1077469107 11:2748514-2748536 CCTCCACGTGGACGCCCAGCTGG - Intronic
1078299035 11:10106497-10106519 CGTGCACCTGTAGTCCCAGGTGG + Intronic
1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG + Intergenic
1081672666 11:44950482-44950504 CGACCCCCTGGGGTCCCAGCGGG + Intronic
1083255326 11:61491851-61491873 AGCCCACATGGAGCCCCAGCCGG - Intergenic
1086729834 11:90235273-90235295 TGTCCACCTGGAGTTCCAGCTGG - Intergenic
1088244043 11:107799700-107799722 CGTGCATCTGTAGTCCCAGCAGG - Intronic
1089855760 11:121543334-121543356 CGGCCAGTTGGAGCCCCATCAGG + Intronic
1089986107 11:122815620-122815642 TGTGCACTTGTGGTCCCAGCTGG + Intergenic
1090025928 11:123167786-123167808 CTTCAACTTGAAGTCACAGCAGG - Intronic
1091715847 12:2775589-2775611 TGTTAACTTGGAGTCCCAGCTGG - Intergenic
1092531638 12:9350041-9350063 CGTCCACTTGCATTTCTAGCTGG - Intergenic
1094502510 12:31033850-31033872 CGTCCACTTGCATTTCTAGCTGG - Intergenic
1095928790 12:47605740-47605762 CCCCCACATGGAGTCCCTGCTGG - Intergenic
1099689620 12:85936517-85936539 CGTATAATTGGAGTCCCAGGGGG + Intergenic
1100316246 12:93447362-93447384 CTTGCACTTTGAGTCCCAGAAGG - Intergenic
1101088141 12:101257090-101257112 TGTCCACTTGGAGTGCTGGCTGG + Intergenic
1101339535 12:103830487-103830509 TGTCTAATTGGAGTTCCAGCAGG - Intronic
1101982528 12:109420076-109420098 CATCTATTTAGAGTCCCAGCTGG + Intronic
1103048718 12:117761027-117761049 CGTCCACGCGGTGCCCCAGCTGG + Exonic
1106514446 13:30440943-30440965 CGCACACCTGTAGTCCCAGCTGG + Intergenic
1117536358 14:56706834-56706856 TGTACACCTGTAGTCCCAGCTGG - Intronic
1121472739 14:94167872-94167894 CGTCCACTTGGAGCTGCAGATGG + Intronic
1122092102 14:99347626-99347648 TGTGCACTGGGAATCCCAGCTGG + Intergenic
1122550575 14:102547005-102547027 TGTGCACCTGTAGTCCCAGCTGG + Intergenic
1122880057 14:104686731-104686753 CGGCCACTTGCAGGCCCAGAAGG - Intergenic
1123964284 15:25439228-25439250 CGGCCCCTCGGAGTCCCACCAGG + Intergenic
1124183264 15:27498618-27498640 CGTGCACCTGTAGTCCCAGCAGG - Intronic
1124815023 15:32981360-32981382 CAGGCACTTGTAGTCCCAGCCGG + Intronic
1127097837 15:55531127-55531149 GGTCCACTTGGAGTGCAGGCTGG + Intergenic
1128032692 15:64495647-64495669 CCTCCACCTGGAGGCCCAGGTGG - Intronic
1129498411 15:76010345-76010367 TGTCAAATTGGAGTCCCAGTGGG - Intronic
1130977783 15:88790464-88790486 CATCCACTTGGAGTCCACACTGG - Intergenic
1132523382 16:401746-401768 CGCCGACTTCCAGTCCCAGCAGG + Intronic
1133302039 16:4788267-4788289 CGTCCACCAGGTGTCACAGCAGG - Exonic
1134094702 16:11411715-11411737 GGTCCCATGGGAGTCCCAGCAGG + Intronic
1136237309 16:28922593-28922615 CGAGCACCTGTAGTCCCAGCTGG + Intronic
1136489886 16:30600424-30600446 GGTCAATTTGGAGTCACAGCAGG + Intergenic
1137543058 16:49377880-49377902 CCTCCATTTGGAGACCCAGTGGG - Intronic
1141416646 16:83880633-83880655 CGTCCAACTGGAGTGCCTGCTGG + Intergenic
1141420505 16:83912301-83912323 CCACCCCTTGGAGTCCCTGCTGG - Exonic
1145036096 17:19541618-19541640 CGTCCACTTGGAGTCCCAGCGGG - Intronic
1147539648 17:41346569-41346591 CACCAACGTGGAGTCCCAGCTGG - Exonic
1147541598 17:41364900-41364922 CACCAACGTGGAGTCCCAGCTGG - Exonic
1147545075 17:41394969-41394991 CACCAACGTGGAGTCCCAGCTGG - Exonic
1147686203 17:42288264-42288286 GGTCCCCCGGGAGTCCCAGCAGG - Exonic
1148805472 17:50261723-50261745 CCTCCACTTGGATGCCCTGCAGG - Intergenic
1149604943 17:57917890-57917912 CCTCCACTAGGAATGCCAGCTGG + Intronic
1149724524 17:58879901-58879923 CATCCTCTTAGGGTCCCAGCTGG + Intronic
1152068570 17:78124398-78124420 TGGCCACCTGGAGTCACAGCGGG + Intronic
1152219445 17:79054383-79054405 CGTGCAACTGGAGTCCCAGGAGG + Intergenic
1152743794 17:82030184-82030206 CCTCAACTTGCAGGCCCAGCTGG - Exonic
1154260477 18:12827512-12827534 CACGCACCTGGAGTCCCAGCTGG - Intronic
1156067655 18:33164227-33164249 CGTGCACCTGTAATCCCAGCTGG - Intronic
1156829077 18:41468751-41468773 CCTCCACCTGGAGCCCCAGGAGG - Intergenic
1157297244 18:46455272-46455294 CCTCCACTTTCAGGCCCAGCAGG - Intronic
1158673890 18:59501212-59501234 CATCGACTTGACGTCCCAGCCGG - Intronic
1161515450 19:4693765-4693787 AGTCCTCCTGGAGCCCCAGCAGG + Intronic
1161641304 19:5425095-5425117 CCTCCTCTTGGAGGTCCAGCAGG + Intergenic
1161811319 19:6472845-6472867 AGTCCACCTCCAGTCCCAGCTGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
926211966 2:10878020-10878042 CATCCCCTTGGAGGCTCAGCAGG - Intergenic
927659738 2:24982800-24982822 CAGGCACTTGTAGTCCCAGCTGG + Intergenic
928259643 2:29755251-29755273 CATGGACTTGGAGTCCCTGCCGG + Intronic
932571052 2:72938571-72938593 CCACCACCAGGAGTCCCAGCAGG - Intergenic
943174864 2:184457934-184457956 CGTGCAATTGGAATACCAGCAGG + Intergenic
944513106 2:200483951-200483973 GTTCCAGCTGGAGTCCCAGCAGG - Intergenic
945404153 2:209424375-209424397 CGTCCTCTGGGACTCGCAGCAGG + Intronic
949070759 2:242022704-242022726 CTTCCAGCTGGAGACCCAGCAGG + Intergenic
1170741847 20:19065319-19065341 CCTCCACATGGAGTCCCCACTGG + Intergenic
1173247873 20:41348675-41348697 CTTCCCCTCGGACTCCCAGCTGG + Exonic
1173502901 20:43566508-43566530 TGTGGACTTGGGGTCCCAGCTGG - Exonic
1174492166 20:50907707-50907729 TGTGCACCTGTAGTCCCAGCTGG - Intronic
1175331065 20:58164412-58164434 TGTCCACTTCGATTCTCAGCTGG - Intergenic
1175814487 20:61876423-61876445 CGTCCAATTGGAGAGGCAGCTGG + Intronic
1177923437 21:27183673-27183695 CGCACACCTGTAGTCCCAGCAGG + Intergenic
1181567272 22:23746712-23746734 CATACACTTGCAGTCCCAGGAGG - Intronic
1182768735 22:32778038-32778060 TGTCCTCTTGGAGTGGCAGCTGG - Intronic
1183032173 22:35114472-35114494 CGTGCACGTGGAGCTCCAGCTGG - Intergenic
951297147 3:20951421-20951443 CTTCCAGTAGTAGTCCCAGCTGG - Intergenic
953464325 3:43105771-43105793 CCTCCACTTCAAGTCCCAGGCGG + Intronic
956416316 3:69033941-69033963 CGTGTACCTGTAGTCCCAGCTGG - Intronic
957789017 3:84916707-84916729 TGTCCACCTGGAGACCCAGAAGG + Intergenic
961569553 3:127787952-127787974 CTTCCTCTTGGAGTTCCAGGGGG + Intronic
963042062 3:141077343-141077365 CGCCCACTGGGGCTCCCAGCAGG - Intronic
968050094 3:195648265-195648287 CGTGCACCTGGAGACCCGGCAGG + Intergenic
968097228 3:195940511-195940533 CGTGCACCTGGAGACCCGGCGGG - Intergenic
968304013 3:197637576-197637598 CGTGCACCTGGAGACCCGGCAGG - Intergenic
969582810 4:8075561-8075583 CGCACACCTGTAGTCCCAGCTGG + Intronic
975727533 4:77306455-77306477 AGTGCATTTGGATTCCCAGCTGG - Intronic
976813657 4:89122637-89122659 TGTCCACCTGGAGTACTAGCTGG - Intergenic
982863368 4:160481852-160481874 CCCGCACTTGGAGCCCCAGCTGG + Intergenic
984472779 4:180197606-180197628 CGTCCACCTGGAGTGCTGGCTGG + Intergenic
985429284 4:189862908-189862930 CGTGCACCTGTGGTCCCAGCAGG - Intergenic
985741442 5:1619547-1619569 CGTGCAGCTGGAGACCCAGCGGG - Intergenic
985741453 5:1619594-1619616 CGTGCACCTGGAGACCCGGCGGG - Intergenic
985741602 5:1620334-1620356 CGTGCACCTGGAGACCCAGGGGG - Intergenic
986023345 5:3825396-3825418 CGTCCACGTGAAGTCCCCTCAGG + Intergenic
986697225 5:10368510-10368532 TGTGCACATGTAGTCCCAGCTGG + Intronic
987346295 5:16981822-16981844 CTTTCACTTGGAGCCTCAGCTGG + Intergenic
987707158 5:21471881-21471903 CCTCCACTCTGAGTCTCAGCAGG + Intergenic
1001555145 5:172631998-172632020 CGTGCACCTGTAGTCCCAGGAGG + Intergenic
1002853822 6:1020477-1020499 CATTCACTTGGGGCCCCAGCTGG + Intergenic
1002998781 6:2311725-2311747 AACCCACTTGGAGTCCCACCGGG - Intergenic
1003975728 6:11342222-11342244 CGTCTATTTGGTGTCCCAGAAGG + Intronic
1005648346 6:27864025-27864047 CGTCCACTTGGAACCCCACTAGG - Intronic
1007553212 6:42746013-42746035 CGGAGACATGGAGTCCCAGCGGG - Exonic
1008669036 6:53747785-53747807 CATCCACTGGGAGTCCCAGAAGG + Intergenic
1009021067 6:57948616-57948638 CCTCCACTCTGAGTCTCAGCAGG - Intergenic
1012549465 6:100454085-100454107 GGGCCACTTGGAGTCCTACCAGG - Intronic
1012983120 6:105850596-105850618 CGTCCACATGGAGTCCCCATAGG - Intergenic
1014906648 6:127038142-127038164 CCTACACTTGGGGTCCTAGCAGG - Intergenic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1020030444 7:4929170-4929192 CGTGACCATGGAGTCCCAGCTGG - Intronic
1024598225 7:50957711-50957733 CATCTACTCAGAGTCCCAGCAGG - Intergenic
1028516252 7:91680882-91680904 CCTCCACATGGAGTCCCCACTGG - Intergenic
1030057990 7:105600259-105600281 CGGGCACCTGCAGTCCCAGCGGG - Intronic
1033183267 7:139201615-139201637 TGTGCACTTGTAGTCCCAGCAGG - Intergenic
1033724139 7:144095143-144095165 GGTCCACCTGGAATCCCAACAGG - Exonic
1035344009 7:158186482-158186504 CGTCCTCTTGGAAGCCCACCTGG + Intronic
1038315698 8:26482661-26482683 AGTCCACTTGGAGTCAGGGCTGG + Intronic
1040950338 8:52932762-52932784 CATGTACTTGGGGTCCCAGCAGG + Intergenic
1045227263 8:100261222-100261244 CATGCACCTGTAGTCCCAGCTGG - Intronic
1047203087 8:122782429-122782451 CGTCCCGGTGGAGTCCCCGCGGG - Intronic
1048146193 8:131846230-131846252 TGTGCACCTGTAGTCCCAGCTGG + Intergenic
1050624388 9:7487567-7487589 CTTCCCCTTGGGTTCCCAGCAGG - Intergenic
1051371859 9:16365576-16365598 CGTGCACTTGGTGGACCAGCTGG - Intergenic
1056606665 9:88091265-88091287 CATGCACCTGTAGTCCCAGCTGG + Intergenic
1056687101 9:88775892-88775914 CGTCCACTTGACTTCCCAACAGG - Intergenic
1061215247 9:129217982-129218004 CGTGCACATGGGCTCCCAGCCGG + Intergenic
1190425496 X:50331303-50331325 GATCCACCTGGAGTCCCACCGGG - Intronic
1191717071 X:64200992-64201014 TATCCACTTGGAAGCCCAGCGGG + Intronic
1192186736 X:68952206-68952228 CGTCCACCTGGAACTCCAGCTGG - Intergenic
1198227675 X:134660688-134660710 TGTCCAGTTGGAGTTCCAGAAGG + Intronic
1201222155 Y:11782187-11782209 CCTGCACCTGGACTCCCAGCAGG + Intergenic