ID: 1145036686

View in Genome Browser
Species Human (GRCh38)
Location 17:19545778-19545800
Sequence TAAGAATTGTTGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2905
Summary {0: 1, 1: 8, 2: 70, 3: 463, 4: 2363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145036686_1145036693 30 Left 1145036686 17:19545778-19545800 CCACACCTGGCCAACAATTCTTA 0: 1
1: 8
2: 70
3: 463
4: 2363
Right 1145036693 17:19545831-19545853 ATCCCATCTGTAGGAACAGTGGG 0: 1
1: 2
2: 13
3: 44
4: 222
1145036686_1145036692 29 Left 1145036686 17:19545778-19545800 CCACACCTGGCCAACAATTCTTA 0: 1
1: 8
2: 70
3: 463
4: 2363
Right 1145036692 17:19545830-19545852 AATCCCATCTGTAGGAACAGTGG 0: 1
1: 3
2: 8
3: 38
4: 214
1145036686_1145036690 21 Left 1145036686 17:19545778-19545800 CCACACCTGGCCAACAATTCTTA 0: 1
1: 8
2: 70
3: 463
4: 2363
Right 1145036690 17:19545822-19545844 ACACCAGAAATCCCATCTGTAGG 0: 1
1: 0
2: 5
3: 43
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145036686 Original CRISPR TAAGAATTGTTGGCCAGGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr