ID: 1145037358

View in Genome Browser
Species Human (GRCh38)
Location 17:19550815-19550837
Sequence CACAGGGGACAACCTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145037358_1145037368 13 Left 1145037358 17:19550815-19550837 CCCTCTGCAGGTTGTCCCCTGTG 0: 1
1: 0
2: 2
3: 19
4: 181
Right 1145037368 17:19550851-19550873 GTATCCCCTGTCTTCTTATGAGG 0: 1
1: 0
2: 0
3: 8
4: 120
1145037358_1145037360 -9 Left 1145037358 17:19550815-19550837 CCCTCTGCAGGTTGTCCCCTGTG 0: 1
1: 0
2: 2
3: 19
4: 181
Right 1145037360 17:19550829-19550851 TCCCCTGTGCATTCATCCCCCGG 0: 1
1: 0
2: 0
3: 13
4: 203
1145037358_1145037372 29 Left 1145037358 17:19550815-19550837 CCCTCTGCAGGTTGTCCCCTGTG 0: 1
1: 0
2: 2
3: 19
4: 181
Right 1145037372 17:19550867-19550889 TATGAGGACACGAGTCCTATTGG 0: 1
1: 8
2: 113
3: 680
4: 1705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145037358 Original CRISPR CACAGGGGACAACCTGCAGA GGG (reversed) Intronic
900500968 1:3004430-3004452 CACAGGGCTCAACCTGCAAGGGG - Intergenic
900526388 1:3130909-3130931 AACAGGGCACAACCTGCAGAAGG - Intronic
900918265 1:5653277-5653299 GACAGGGGAGACCCTGCTGAGGG + Intergenic
902336557 1:15757995-15758017 CACCGGGACCCACCTGCAGAGGG + Intronic
902672991 1:17987933-17987955 CTCAGGGGACATCGAGCAGAGGG + Intergenic
903222299 1:21875693-21875715 CACACGGGAGCACCTGCTGATGG - Exonic
908145870 1:61242458-61242480 CACAGAGTACAAACTGCAGAGGG - Intronic
910502555 1:87909510-87909532 CACTGGGGACAATCTGTACATGG - Intergenic
911090937 1:94016356-94016378 CTCAGGGGGCAACCTGCCGTGGG + Intronic
911477819 1:98395381-98395403 CAAAGAGGCCAACCTGCAAAGGG - Intergenic
915940224 1:160114241-160114263 CAGAGGGAACTCCCTGCAGAGGG - Intergenic
916804281 1:168243547-168243569 CACTGGGGATAAACTGCAGGTGG + Exonic
918251210 1:182704940-182704962 CACAGGTCACAACCTGCAGTAGG - Intergenic
918654204 1:187003645-187003667 CACATGGGACAGCCTACAGGAGG - Intergenic
922565131 1:226596768-226596790 CAGAGGGGACAGCCTTCTGAGGG - Intronic
922887405 1:229030841-229030863 CACAGGTGACAACAAGGAGAGGG - Intergenic
922957959 1:229620492-229620514 AAGAGGGGACAACCTGCATGAGG - Intronic
1064607850 10:17062688-17062710 CACATGGCACAAACTACAGATGG + Intronic
1065023570 10:21520296-21520318 CACAGGAGACAAAATGCACAAGG + Intronic
1066259550 10:33715793-33715815 CCGGGGGGACAAACTGCAGAGGG - Intergenic
1070334476 10:75441950-75441972 CACATGGCACAACCTTTAGAAGG + Intronic
1071677448 10:87668225-87668247 CACATGGGACCCCCAGCAGAGGG - Intronic
1072378798 10:94844753-94844775 CACAGGAGATAACCAGGAGAAGG + Intronic
1074871688 10:117581969-117581991 CACTGGGGACACCCAACAGAAGG + Intergenic
1075785879 10:125049776-125049798 CAAAGGGGCCCACCTGCTGAAGG + Intronic
1078161801 11:8846538-8846560 GACAGGGCAGAACCTACAGATGG + Intronic
1078331569 11:10426381-10426403 CACAGAGGACAAGCTGAAGCAGG - Intronic
1081546864 11:44077877-44077899 CACAGTGGAGAAGCTGGAGATGG + Exonic
1082025669 11:47569762-47569784 CACCTTGGACAACCTCCAGAAGG + Exonic
1083053221 11:59795410-59795432 CACAGTGGACCACGTGGAGAAGG + Exonic
1083796835 11:65021780-65021802 CACCGGGGAGAACCTGCTGCCGG + Exonic
1083805910 11:65073819-65073841 GACAGGGGAGGGCCTGCAGATGG + Intronic
1084618987 11:70255548-70255570 CACAGGGGACTAACTACAGATGG - Intergenic
1085777131 11:79377083-79377105 CACAGGCGATAACATGGAGATGG + Intronic
1086093509 11:83027473-83027495 CCCAAGGGAAAACCTGAAGATGG + Intronic
1087482451 11:98718453-98718475 CACAGGGGGCAAGCTGAAGCAGG - Intergenic
1087758220 11:102077290-102077312 CACAGGTGAGAATCTGGAGAAGG - Intronic
1090976705 11:131685493-131685515 TACAGGGGACCAGCTGAAGATGG - Intronic
1091269214 11:134293827-134293849 CACAAAGGACAACCAGGAGAGGG - Intronic
1091395587 12:152455-152477 CACAGGGGACCACCTGCCCCAGG + Intronic
1092117317 12:6018725-6018747 CAAAGGGGACATCCTGCAGCGGG - Exonic
1093753757 12:22830094-22830116 CACAGGGGAGAAGCTGCCCAAGG + Intergenic
1095320574 12:40820656-40820678 CACTGTGAACAACCTGGAGAGGG - Intronic
1095800998 12:46269553-46269575 CCCTGGGCACAGCCTGCAGATGG + Intronic
1099700900 12:86080177-86080199 AACAGGAGACAAAATGCAGAGGG - Intronic
1101037075 12:100716945-100716967 CCCAGGGGACAGTCTGGAGAAGG - Intergenic
1101770543 12:107746412-107746434 CACAGAGTACACCCTGTAGATGG + Exonic
1102503801 12:113371413-113371435 CACAGAGGACAACGTCCAGTGGG + Intronic
1102746335 12:115252004-115252026 CACAGGTGAGAACCCGGAGATGG + Intergenic
1104411240 12:128559831-128559853 CACAAGGTACAGCCTGCACATGG - Intronic
1106539149 13:30674429-30674451 CCCAGGGGAGAACCTGCCAAGGG + Intergenic
1110906637 13:80897953-80897975 GACAGGGGAAGACCAGCAGAAGG + Intergenic
1113469504 13:110534396-110534418 CTCAGGGGACAGCCTGAAAATGG - Intronic
1113545357 13:111144859-111144881 CACATGGGACAACATTCAAAGGG + Intronic
1113946262 13:114045424-114045446 GACGGGGGACCAGCTGCAGAGGG + Intronic
1116513572 14:45778674-45778696 CACATGGAACAACCTCCAGATGG - Intergenic
1117045935 14:51813383-51813405 AACAGGTGACAGGCTGCAGAGGG - Intergenic
1128375512 15:67071834-67071856 AAAAGTGGACAACTTGCAGATGG + Intronic
1129004046 15:72357497-72357519 CACAGGGAAGAACCAGCAGGAGG - Intronic
1131667875 15:94589672-94589694 CACTGGGCAAAACCTGCAGTGGG + Intergenic
1132145519 15:99426980-99427002 CACAGGCCACACCCTGCAGCAGG + Intergenic
1132473046 16:117620-117642 CACAGGGGACGAGATGGAGAGGG + Intronic
1135256954 16:20948636-20948658 CCCTGGGGACAACCAACAGAAGG + Exonic
1136172097 16:28495692-28495714 GGCAGGGGACAACCGGGAGATGG + Exonic
1139403141 16:66697323-66697345 CGGCGGGGACAACCTGCAGTGGG - Intergenic
1139559383 16:67732055-67732077 TACATGGCACAGCCTGCAGAGGG - Intronic
1139668357 16:68473947-68473969 GAAAGGGGCCAAACTGCAGAGGG - Intergenic
1141617541 16:85218712-85218734 CACAGAGCAGGACCTGCAGAAGG - Intergenic
1141854991 16:86674676-86674698 CACAGGGGACAAACTCCAAGCGG - Intergenic
1144125822 17:12202171-12202193 CTCAGAGGACAACCTTCAGTGGG - Intergenic
1145037358 17:19550815-19550837 CACAGGGGACAACCTGCAGAGGG - Intronic
1145781335 17:27565951-27565973 CTCATGGGACAACCTTCAAAAGG - Intronic
1146513186 17:33468305-33468327 CAGAGGGGAGAACATGGAGATGG - Intronic
1146526727 17:33573069-33573091 CACAGGTGCCAATCTTCAGAGGG + Intronic
1148850927 17:50554798-50554820 CACAGAGGCAAACCTGCAGATGG - Intronic
1149514916 17:57273733-57273755 CACTGGGGTCATGCTGCAGAGGG - Intronic
1149854848 17:60073087-60073109 CACAGGGAACTACCTACAAAGGG + Intronic
1149940535 17:60860423-60860445 AACAGCAAACAACCTGCAGAAGG - Intronic
1152296443 17:79469857-79469879 CACAGGGGAGAACGTGCACAAGG + Intronic
1152409662 17:80117088-80117110 CACATGGTACGACCTGCAGACGG + Intergenic
1152570297 17:81118749-81118771 CACAGGGGGCACCCTGCACCAGG + Intronic
1152660891 17:81541404-81541426 CACAGGAGACATGCTGGAGAGGG + Intronic
1154165047 18:12008570-12008592 CACAGGGACCAGCCTGCAGAAGG + Intronic
1161420044 19:4171612-4171634 CACAGGGGACAAGGTGGAGGTGG - Intronic
1163757182 19:19113117-19113139 CACAGGAGGCCCCCTGCAGAGGG - Intergenic
1166259066 19:41625490-41625512 AACACGGGACAAAATGCAGAGGG + Intronic
1167218977 19:48184986-48185008 CACAGGGACAATCCTGCAGAGGG - Intronic
1167674773 19:50877438-50877460 GGGAGGGGACATCCTGCAGAAGG + Intronic
1168642355 19:58038729-58038751 CACAGGGGCAAAGATGCAGAAGG - Intronic
925741356 2:7008335-7008357 GACTGGGCACAACCTGCAGCCGG - Intronic
928023286 2:27720632-27720654 CACAGGGGACAACCATGTGAGGG - Intergenic
930878610 2:56247402-56247424 TACAGGGGAAAAATTGCAGAAGG - Intronic
931284308 2:60819579-60819601 CACAAGGGAAGACCTGCTGAGGG + Intergenic
934943155 2:98516840-98516862 CAGAGGGGACAGCCAGCAGGCGG - Intronic
936268648 2:111031481-111031503 CACAGAGGCCAGCCTACAGAAGG + Intronic
936401076 2:112164873-112164895 CACAGTGCACAGCCTGCAGCAGG + Intronic
937095426 2:119232360-119232382 CACAGGGTTTGACCTGCAGAAGG - Intronic
937248481 2:120509355-120509377 CCCAGGAGACAAGCCGCAGAGGG + Intergenic
938954046 2:136282367-136282389 CACTGGGGACAAACAGGAGAAGG - Intergenic
938956848 2:136306989-136307011 CACGTGGGAAGACCTGCAGATGG - Intergenic
940198233 2:151120525-151120547 CAGAGGTGACAACCAGGAGAAGG - Intergenic
942552044 2:177129822-177129844 CTCAGGGGAGGACCTGCAGTTGG - Intergenic
945866606 2:215182822-215182844 CATAGGGGGCTGCCTGCAGATGG - Intergenic
947759488 2:232593423-232593445 CAGAGGGCACAAGCTGGAGAAGG + Intergenic
948737016 2:240015778-240015800 CACACGTGAAAAGCTGCAGAGGG - Intronic
948795587 2:240400647-240400669 CAAAGGGGACAGGCTGCAGACGG + Intergenic
1168859715 20:1037191-1037213 GACAGGGGACACCCTTTAGATGG + Intergenic
1171982813 20:31639154-31639176 CAAAGGGGGCAGCCTGCAGAGGG - Intronic
1172575891 20:36008399-36008421 TACAGGGGACAAGCTTCAGCAGG + Exonic
1173111098 20:40191330-40191352 GACAGGGAACTACCTGAAGAGGG + Intergenic
1175120909 20:56715537-56715559 CGCTGGGGAAAACCTGCAGAAGG - Intergenic
1175750428 20:61493410-61493432 CAGAGGTGATGACCTGCAGAGGG - Intronic
1175988567 20:62776486-62776508 CACAGGGGACAGCAGGCAGAGGG + Intergenic
1177533701 21:22397239-22397261 CAGAGGGGAGAACCTGCATGTGG + Intergenic
1179302895 21:40128404-40128426 CACATGGCACAACCTGCCCATGG - Intronic
1179316230 21:40246693-40246715 CACAGTGGATAGCCTGGAGAGGG + Intronic
1180568754 22:16697138-16697160 CAAAGGGGACATCCTGCAGCGGG - Intergenic
1180848424 22:18997372-18997394 CACAGGGGCCGAAATGCAGACGG + Intergenic
1182854466 22:33504962-33504984 CAAAGGTGACAACCTCCAGGTGG + Intronic
1183227473 22:36560353-36560375 CTCAGGGGGCTCCCTGCAGAGGG - Intergenic
1183281502 22:36935031-36935053 CACAGGGGACTTCCTGAAGGAGG - Intronic
1183362397 22:37389513-37389535 CAGGGGGGTCACCCTGCAGAAGG - Intronic
1183495015 22:38138233-38138255 CTCAGGTCACAACCTGCAAATGG + Intronic
1184774696 22:46617344-46617366 CACATGGGAGAACCTACACACGG - Intronic
954706188 3:52481801-52481823 CCCTGGGGACACTCTGCAGAGGG + Intronic
956496286 3:69830227-69830249 AACAGGGGCCAAACTGCAGAAGG - Intronic
959838906 3:110951455-110951477 CACAGGGTACAAGCTGCTGGTGG - Intergenic
960998108 3:123352569-123352591 CATTGGAGACAAGCTGCAGAGGG + Exonic
964975561 3:162615083-162615105 CACAGGGGCAAACCTGCCTAAGG + Intergenic
966135384 3:176692387-176692409 TACCGTGGACAAGCTGCAGAGGG - Intergenic
968728680 4:2259854-2259876 CACTGGGGCCAGCCTGCAGGGGG - Intronic
969291447 4:6242682-6242704 CAAAGGGGACTACATGTAGATGG - Intergenic
969461905 4:7333477-7333499 CACAGGGCCCAGCCTGCAGGAGG + Intronic
975066232 4:70067376-70067398 CACAGTGGAAAATCTGCAGTGGG - Intergenic
976484700 4:85588062-85588084 CTGAGGGGATAACATGCAGAGGG + Intronic
976719552 4:88156429-88156451 CACAGGCGCCAACCTGAAAAAGG + Intronic
978227407 4:106353752-106353774 CAAAAGGGACAACCTGCAAGGGG + Intergenic
981374299 4:143995980-143996002 AACAGCGGAGAACATGCAGAAGG - Intergenic
981390237 4:144181551-144181573 CAGAGCGGACATCCTGCAGAAGG - Intergenic
982122429 4:152156077-152156099 CACAGGGAACAGCCTGAAGAGGG - Intergenic
982816020 4:159885881-159885903 CAAAGGGGAAAACAAGCAGAAGG - Intergenic
983015572 4:162608167-162608189 CACAGGGTACAAGCTGCTGGTGG - Intergenic
983117944 4:163843021-163843043 CACCGGGGACTACTTGAAGAGGG - Intronic
985120465 4:186635963-186635985 CACTGAGGAGAACCTGCATACGG - Intronic
985604710 5:852500-852522 CACAGAGGACAACGAGCAGCGGG + Intronic
986205800 5:5623880-5623902 CACAGGGGCAAAGCTGCACAAGG + Intergenic
986337156 5:6763715-6763737 CACTGGGGACAACAGGCAGGGGG - Intergenic
986338187 5:6770083-6770105 CACAGAGGACATCCTGCCTATGG - Intergenic
987662503 5:20894881-20894903 CACAGGGGCCAGCCTGCCCAAGG + Intergenic
990110878 5:52322570-52322592 CACAGCGGACAACATACAGCCGG + Intergenic
990721953 5:58706650-58706672 CACAAGAGACAAGTTGCAGATGG - Intronic
992146924 5:73859920-73859942 CACAGAGGTCAAAATGCAGATGG - Intronic
997487952 5:134247829-134247851 CACAGGTTAAAACCTGGAGACGG + Intergenic
997813651 5:136996025-136996047 CAAAGGCAACAGCCTGCAGAGGG + Intronic
998138006 5:139684584-139684606 CACAGAGGCCAACCTGAAGGAGG + Intergenic
999005424 5:147971316-147971338 TACAGGGGACACCATGCACATGG + Intergenic
999367471 5:151032545-151032567 CAGAGGGGATAACTTGCTGAAGG + Intronic
1002538037 5:179888931-179888953 CACAGCAGTCACCCTGCAGAGGG + Intronic
1004947268 6:20629750-20629772 TACAGGGGGCAACCAGCACAGGG - Intronic
1006360864 6:33586367-33586389 CACTGGGGACAGCATGCAAAGGG - Intergenic
1008678640 6:53848118-53848140 CACAGGAGACATCCAGCAAAGGG + Intronic
1013407202 6:109853772-109853794 CAGTGTGGACAACCTGCAGAAGG + Intergenic
1015495188 6:133874531-133874553 CACAGAAGTCAACCAGCAGAAGG + Intergenic
1021586813 7:22217596-22217618 CACTGGTGTCATCCTGCAGAAGG + Intronic
1024666468 7:51551748-51551770 CACCTGGCACAAGCTGCAGAAGG - Intergenic
1029667964 7:102008080-102008102 CAGAGGGGAAAGCCTGGAGATGG - Intronic
1030450988 7:109710789-109710811 CACAAGGGACAGCCTGAAGTAGG - Intergenic
1034192624 7:149223807-149223829 CCCAGGTGACAGCCTGCTGATGG + Exonic
1034621876 7:152463347-152463369 CACATGAGAAAACCTGGAGAAGG + Intergenic
1034751370 7:153571866-153571888 CACAGGGGAGAATCTGCCCAAGG + Intergenic
1037788464 8:21917130-21917152 CACAGGGGACAACTTTCAAGAGG + Intergenic
1039981904 8:42415287-42415309 CACAGGAGCCACCTTGCAGAGGG + Intergenic
1041108242 8:54461684-54461706 CTCTTGGGACACCCTGCAGAAGG - Intergenic
1041279307 8:56195516-56195538 AGCAGGGGAGAACATGCAGAGGG + Intronic
1043110448 8:76173146-76173168 CACAGGAGAAGAGCTGCAGAGGG - Intergenic
1043150035 8:76704226-76704248 CACAGATGACAACCTGAAAACGG + Exonic
1043421146 8:80100182-80100204 CAAAGGGCACAAATTGCAGAAGG + Intronic
1045113933 8:98961828-98961850 CACAGGGTACAGTCTGCTGATGG - Intergenic
1046935634 8:119882979-119883001 CACGGGGGACATCGTGAAGATGG + Intronic
1049640328 8:143712346-143712368 CACAAGGGACAAGGTGCACAGGG - Intronic
1050796915 9:9557762-9557784 CACATGGGACAACTTGAAGGGGG - Intronic
1054895643 9:70307854-70307876 CACAGGAGTCAACCTGAAAATGG - Intronic
1055562036 9:77530772-77530794 CACATGGGAGAACCCCCAGATGG + Intronic
1057567810 9:96180560-96180582 TACAGGGGAAGACCTGCAGCTGG - Intergenic
1057857406 9:98612052-98612074 CTCTGGGGACAATCTGCAGGTGG - Intronic
1060299743 9:122368251-122368273 CCCATGGGACAAGCTGGAGAAGG + Intergenic
1062236973 9:135515008-135515030 CCCAGGAGACAACCTGGACAGGG + Intergenic
1062390822 9:136333214-136333236 CTCCGGGGGCACCCTGCAGATGG + Intronic
1187701251 X:21966264-21966286 CACAGGAGCCAGCCTTCAGAGGG + Intronic
1188825702 X:34831727-34831749 CAGAACAGACAACCTGCAGAGGG + Intergenic
1189212784 X:39298920-39298942 CACAGGTGAGAACCTCCAGATGG - Intergenic
1191690896 X:63936842-63936864 CACAGGTAATATCCTGCAGAGGG - Intergenic
1192506131 X:71684884-71684906 CACAGGGGTCAGCCTGGAGCTGG + Intergenic
1192520566 X:71796664-71796686 CACAGGGGTCAGCCTGGAGCTGG - Intergenic
1192524198 X:71827903-71827925 CACAGGGGTCAGCCTGGAGCTGG + Intergenic
1194456082 X:94105424-94105446 CACTGGGGCCTACCTGAAGATGG - Intergenic
1194941285 X:100014460-100014482 CACAGAAGACAACCAACAGAAGG + Intergenic
1195048986 X:101079867-101079889 CAGAGGGGAAAACCTGCAGAGGG - Intronic
1196543333 X:116934741-116934763 CACATGGTGCAACCTGGAGATGG - Intergenic
1199612819 X:149632064-149632086 CACTGGGGAAAATCTCCAGAAGG - Intergenic
1199617703 X:149671137-149671159 CCCAGGGGACACACTGGAGATGG + Intergenic
1199624940 X:149732112-149732134 CCCAGGGGACACACTGGAGATGG - Intergenic
1199896466 X:152131805-152131827 CACTGGGGACAACCAGGGGAAGG + Intergenic