ID: 1145037541

View in Genome Browser
Species Human (GRCh38)
Location 17:19551828-19551850
Sequence CAGGCTGGGGGCAGCTCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145037531_1145037541 28 Left 1145037531 17:19551777-19551799 CCAGCGTCCTGGAAAGAAGGGTG 0: 1
1: 0
2: 2
3: 7
4: 146
Right 1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG 0: 1
1: 0
2: 2
3: 20
4: 253
1145037532_1145037541 21 Left 1145037532 17:19551784-19551806 CCTGGAAAGAAGGGTGCATGCCC 0: 1
1: 0
2: 0
3: 16
4: 291
Right 1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG 0: 1
1: 0
2: 2
3: 20
4: 253
1145037533_1145037541 1 Left 1145037533 17:19551804-19551826 CCCATTTGCTCCTAAGACAGAGC 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG 0: 1
1: 0
2: 2
3: 20
4: 253
1145037534_1145037541 0 Left 1145037534 17:19551805-19551827 CCATTTGCTCCTAAGACAGAGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG 0: 1
1: 0
2: 2
3: 20
4: 253
1145037537_1145037541 -9 Left 1145037537 17:19551814-19551836 CCTAAGACAGAGCGCAGGCTGGG 0: 1
1: 0
2: 2
3: 20
4: 219
Right 1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG 0: 1
1: 0
2: 2
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145037541 Original CRISPR CAGGCTGGGGGCAGCTCGTC TGG Intronic
900104454 1:976382-976404 CAGCCTGGGGGGAGCAGGTCAGG + Intronic
900149380 1:1171524-1171546 CAGGCTGGGAGCAGCAGATCCGG - Intergenic
900184605 1:1327186-1327208 CAGGCCTGGGGCAGCCCGCCTGG - Intronic
900436690 1:2634393-2634415 CAGGCTGGGGGCTGCTGGGCTGG - Intergenic
900447140 1:2686966-2686988 CAGGCTGGCGGATGCTCGCCTGG - Intronic
900448637 1:2694392-2694414 CAGGCTGGCGGATGCTCGCCTGG - Intronic
900449091 1:2696642-2696664 CAGGCTGGCGGATGCTCGCCTGG - Intronic
900452106 1:2755344-2755366 CAGGCTGGCGGATGCTCGCCTGG - Intronic
900452558 1:2757593-2757615 CAGGCTGGCGGATGCTCGCCTGG - Intronic
900452968 1:2759601-2759623 CAGGCTGGCGGATGCTCGCCTGG - Intronic
900514131 1:3073245-3073267 GAGGCTGGTGGCAGCTCGCTGGG + Intronic
900557142 1:3286352-3286374 CAGGCAGGGGGCGGCCCTTCGGG - Intronic
900854074 1:5166726-5166748 CAGCCTGGGCACAGGTCGTCAGG - Intergenic
902391953 1:16112143-16112165 CAGGCTTGGCGCATCTAGTCAGG + Intergenic
903750167 1:25616665-25616687 CCGGCTGAGGGCCGCGCGTCCGG - Intergenic
903808572 1:26022150-26022172 CAGGCTGGAGGGAGCTGGGCTGG - Exonic
903808738 1:26022808-26022830 CAGGCTGGGAGAAGCTCTGCAGG - Exonic
905271853 1:36792550-36792572 AAGGCTGGGGTCCACTCGTCTGG - Intergenic
905626072 1:39491428-39491450 CAGGCTGCGGGCTCCTCGCCCGG + Intergenic
905825563 1:41023699-41023721 CAGGCTGGAGGCAGCACGCTAGG - Intergenic
906184453 1:43851018-43851040 CAGGCTGGTGGCAGCTGGCGTGG - Intronic
907295372 1:53448645-53448667 CAGGATGGGGGCTGCTCACCAGG - Intergenic
913282930 1:117202761-117202783 CAGGCTGGAGCCAGGTTGTCTGG - Intronic
914821884 1:151111136-151111158 CAGGCTGGGGCCACCACATCTGG - Intronic
915583617 1:156831136-156831158 CAGTCTGGGGGCATCTGGGCTGG + Intronic
915708589 1:157871368-157871390 CAGGATGTGGGCAGCCAGTCCGG + Intronic
916330245 1:163607999-163608021 CAGGCTGGGAGAAGCTTGTCAGG - Intergenic
919631706 1:199965978-199966000 CAGGCTTGAGCCAGCTCGCCTGG + Intergenic
919799725 1:201346390-201346412 CAGGCTGGGGGCAGTGTGTGGGG - Intergenic
923012201 1:230096654-230096676 CAGCCTGGGGGCAGCAGGTTGGG + Intronic
1062774138 10:131371-131393 CAGGCTCCGGGCATCTCTTCAGG - Intergenic
1067083037 10:43222342-43222364 CTGGCTGGGGGCTGGTTGTCAGG + Intronic
1067106727 10:43371553-43371575 CAGGCTGGAGGGAACTGGTCAGG - Intergenic
1069797176 10:71060962-71060984 GAGGCTGGGGGCAGCTCCACTGG + Intergenic
1069842246 10:71347087-71347109 CAGGCTGTGGGAAGATGGTCTGG + Intronic
1072615546 10:97046903-97046925 CAGGGTGGGGGCAGCTCCCACGG - Intronic
1072619425 10:97069710-97069732 CAGGCTGGGGGAATCTCATGTGG + Intronic
1072744092 10:97927973-97927995 GAGGGTGGGGGCAGCTGCTCGGG + Intronic
1073749241 10:106505176-106505198 CAGGCTGGGGGCAGTGGCTCAGG - Intergenic
1075581968 10:123625673-123625695 CTGGCTGGGTGCAGCTGGGCAGG - Intergenic
1076533691 10:131162109-131162131 CAGGCTGGGGTCAGTCCCTCTGG - Intronic
1076777276 10:132704758-132704780 CAGGCAGCAGGCAGCTCCTCTGG + Intronic
1076777288 10:132704811-132704833 CAGGCGGCAGGCAGCTCCTCTGG + Intronic
1076777299 10:132704864-132704886 CAGGCAGCAGGCAGCTCCTCTGG + Intronic
1076777311 10:132704917-132704939 CAGGCGGCAGGCAGCTCCTCTGG + Intronic
1076777323 10:132704970-132704992 CAGGCGGCAGGCAGCTCCTCTGG + Intronic
1076922264 10:133460114-133460136 CGGGCTGGGGGCGGCACGACTGG + Intergenic
1076923937 10:133471864-133471886 AAGGCTGGGGGCTGCTCTGCTGG - Intergenic
1077079634 11:719473-719495 CAGGCTGGCCGCAGATCCTCAGG + Intronic
1077090494 11:776401-776423 CAGGCTGGGGGCAGCACTTCAGG - Intronic
1077162997 11:1122036-1122058 CAGGCTGGTGGCGGCTGCTCAGG + Intergenic
1077917162 11:6618901-6618923 CAGCCTGGGGGCAGCCTGTAGGG + Exonic
1080418160 11:32088866-32088888 CTGGCTGGGGGAAGCATGTCTGG + Intronic
1080614709 11:33935818-33935840 CTGGCTGGGCACAGCTCGGCAGG + Intergenic
1081529369 11:43947468-43947490 CAGGCTGGGGCCGGCTGGGCTGG + Intergenic
1081618627 11:44605294-44605316 CAGGCTGGGTGCACCTGGTCGGG + Intronic
1081747309 11:45482314-45482336 CAGGGTGGGGGCACTTCGTAGGG - Intergenic
1082119979 11:48369767-48369789 CAGGCTGGAGACAGCTCCTTTGG + Intergenic
1082254308 11:50015439-50015461 CAGGCTGGAGACAGCTCCTTTGG - Intergenic
1083763150 11:64829620-64829642 CGGGATGGTGGCAGCTCCTCAGG + Exonic
1083777448 11:64901134-64901156 GGGGCTGGGGGCAGCTGGGCTGG - Intronic
1084692881 11:70737168-70737190 CAGGCTGGGTGCAGCCCCCCAGG + Intronic
1084873378 11:72112679-72112701 CAGGCTGGGTGAAGCGCTTCCGG - Exonic
1084887699 11:72221774-72221796 CAAGCTGAGGGCAGGTAGTCTGG - Exonic
1084941733 11:72616762-72616784 CCGGGTGGGGGCAGCAGGTCAGG + Intronic
1089217880 11:116846641-116846663 CAGGCTGTGGGATGCTCGACAGG - Intronic
1089775789 11:120834878-120834900 CAGGCTGGGGGCAGAGGGTCCGG - Intronic
1091751345 12:3023031-3023053 CAGGCTGGGAGCTGCTCACCGGG - Intronic
1092508481 12:9128063-9128085 CTGGCCGGGGTCAGCTCATCGGG - Intergenic
1092755200 12:11756753-11756775 CAGGCTGGCAGCACCTCGTGAGG - Intronic
1096601986 12:52735967-52735989 CAGGCTGGGGGCAGGTCACAGGG - Intergenic
1097167543 12:57093766-57093788 CATGGTGGGAGCAGCTCGGCAGG - Intronic
1101598109 12:106185154-106185176 CAGGCAAGGGGCAGCTGCTCTGG + Intergenic
1103794537 12:123494334-123494356 CAGGCTCGGGGCAGCTTTGCTGG - Intronic
1103900512 12:124301421-124301443 CAGACTGGGGGCAGCTTTCCCGG + Intronic
1115606666 14:35009888-35009910 CAGGCTGGGCGCACCACGTTGGG + Intronic
1117250829 14:53935742-53935764 CAGGCTGAGTGCAGCAGGTCAGG + Intergenic
1121505148 14:94471705-94471727 CAGGGTGGGGGCAGCTCTGGAGG - Intronic
1122298281 14:100717679-100717701 GAGGCTGGGTGCAGCTCCCCAGG + Intergenic
1122898360 14:104771650-104771672 TAGGCTGTGTGCAGCTGGTCGGG - Intronic
1123084471 14:105711145-105711167 CAGGCTGGGGTGAGCTAGGCTGG - Intergenic
1124112695 15:26806836-26806858 GAGGTGGGGGGCAGCCCGTCTGG + Intronic
1127836874 15:62797357-62797379 CAAGCTGGGGGCAGCCAGCCTGG + Exonic
1128300785 15:66565293-66565315 CAGGCTGGGGGCCGCCCGGAAGG - Exonic
1129198034 15:73982638-73982660 CAGGCTGGGGGCTGTTCTTAAGG + Exonic
1129236331 15:74225864-74225886 CAGGCTGGGGGTGGCTGGGCTGG - Intergenic
1129458327 15:75687528-75687550 CTCGCTGGGGACAGCTAGTCCGG - Exonic
1129663189 15:77564836-77564858 CAAGATGGGGGCAGGTCCTCAGG - Intergenic
1130986989 15:88851092-88851114 GAGGCTGGGGGCAGCATGGCTGG - Intronic
1131426042 15:92346288-92346310 CAGGATGGGGGCTGGTTGTCAGG + Intergenic
1132664072 16:1073666-1073688 CAGGCTGGGGACAGCGGGTCGGG - Intergenic
1133326077 16:4943198-4943220 CGGGCTTGGGGCAGCTGGGCTGG + Intronic
1133390797 16:5408382-5408404 CAGGCTGGGGGCAGCATGGGAGG + Intergenic
1136105407 16:28026569-28026591 CAGGCTGGACGCAGCTCAGCTGG + Intronic
1136779289 16:32886570-32886592 GAGGCTGGGACCAGCTCTTCAGG + Intergenic
1136891328 16:33974948-33974970 GAGGCTGGGACCAGCTCTTCAGG - Intergenic
1137722931 16:50638427-50638449 GGGGCTGGGTGCAGCTGGTCTGG - Exonic
1138384575 16:56627431-56627453 CAGGCCGGGCGCAGCTACTCAGG + Intergenic
1139708883 16:68761298-68761320 CAGGCTTGGGGCAGCCCCGCTGG + Intronic
1139923698 16:70474467-70474489 CAAGCTGGGGGCAGATTGCCTGG - Intronic
1139965495 16:70742765-70742787 CAGGCTGGGACCAGCCCGGCTGG + Intronic
1142245798 16:88969541-88969563 CAGGCTGGGGTCAGCGTGGCCGG + Intronic
1142283763 16:89162617-89162639 CAGCCTGGGGCCAGCTCTGCCGG - Intergenic
1142382161 16:89739085-89739107 CCGGCTGGGGGGAGCTCCCCTGG + Intronic
1203081705 16_KI270728v1_random:1148658-1148680 GAGGCTGGGACCAGCTCTTCAGG + Intergenic
1142478743 17:205153-205175 GAGACTGGGGGCACCTCGTCGGG + Intergenic
1143936743 17:10494054-10494076 CAGGCAGGAGGCAGCTCATAGGG - Intronic
1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG + Intronic
1146689720 17:34865100-34865122 GAGGCTGTGGGAAGCTGGTCTGG - Intergenic
1147336055 17:39727525-39727547 CAGGCTGGGGGCTGCAGGTCAGG - Exonic
1147647669 17:42043483-42043505 CAGGCTGGGGGCAGCCCGCCAGG + Intronic
1147970251 17:44215597-44215619 GAGGCTGGGAGCAGCTGGTGTGG - Intronic
1148759047 17:49989962-49989984 GAGGCTGGTGGCAGCTCTTGTGG - Intergenic
1149545385 17:57499697-57499719 CAGGCTGGGAGCATCTCATGAGG + Intronic
1151351528 17:73534813-73534835 TAGGCTGGGGGCAGCGGGCCGGG + Intronic
1151659971 17:75513939-75513961 CAGGCAGTGGGCTCCTCGTCAGG + Exonic
1151880908 17:76893865-76893887 CAGGGTGGGGGCAGGACATCAGG - Intronic
1152187742 17:78868770-78868792 AAGGCTGGGGGCTGCTGGACTGG + Intronic
1152554671 17:81046908-81046930 CGGGCTGGGGGAAGCCCCTCTGG + Intronic
1152748398 17:82051602-82051624 CAGGCTGGGGGCAGCGGGCCGGG + Exonic
1152809314 17:82374067-82374089 GGGGGTTGGGGCAGCTCGTCTGG + Intergenic
1153886801 18:9474992-9475014 CAGACTGGGGGCCGCCCGGCTGG - Exonic
1156514978 18:37671687-37671709 CAGGCAGAGGGCAGGTCGTGGGG - Intergenic
1158725717 18:59969725-59969747 CACGCTGGCGCCAGCTCCTCCGG - Intergenic
1161389454 19:4013656-4013678 CAGGCTGGAGCCACCTCATCTGG + Intronic
1161642191 19:5431267-5431289 CAGGCTGTCAGCAGCTCCTCTGG - Intergenic
1162923618 19:13918742-13918764 GGGTCTGGGGGCAGCTGGTCTGG - Exonic
1163145759 19:15378742-15378764 CATGCTGGGTGGAGCTCGACTGG - Intronic
1164461902 19:28456201-28456223 CAGGCTTGGGGCAGATGGGCAGG - Intergenic
1165128294 19:33616520-33616542 CAGGCTGTGGGGAGCGCATCAGG + Intergenic
1165805938 19:38580580-38580602 CAGGCTGGAGGCACCACGCCCGG - Intronic
925072073 2:977492-977514 CAGGGTGGAGGCAGCGGGTCAGG - Intronic
925103952 2:1273092-1273114 CAGGCAGGGGCGTGCTCGTCAGG - Intronic
925348311 2:3185202-3185224 CAGGCTAGGGGCACCTTGCCCGG - Intergenic
925899296 2:8496870-8496892 CAGGCAGGAGGCAGCTGGCCGGG + Intergenic
926948636 2:18216820-18216842 CAGGCTGGAGCCACCGCGTCCGG - Intronic
927668630 2:25050261-25050283 CAAGCTGGGGGCAGCTGTGCAGG + Intronic
927926586 2:27017995-27018017 CAGCCTGGGGGCAGCTTTCCTGG - Intronic
929545728 2:42854383-42854405 CAGGCTGGGGCCTGCTCCGCTGG - Intergenic
932421859 2:71605935-71605957 CAGGCAGGGGGCAGCCAGGCAGG - Intronic
932699926 2:73985256-73985278 CCGGCGGGGGGCCGCTCCTCCGG + Intergenic
934766977 2:96885166-96885188 CAGGCTGGCAGCAGCTGGACAGG + Intronic
937258244 2:120569545-120569567 CAGGGTGGGGACAGCTGGCCAGG - Intergenic
941262117 2:163310625-163310647 CAGGCTGGGGGCAGCGTGGGGGG - Intergenic
941846804 2:170141711-170141733 CAGGCTGGCGGCAGGGCCTCGGG + Intergenic
945993373 2:216415005-216415027 CAGGCTGTGGGCATTTCTTCTGG - Exonic
946170820 2:217894377-217894399 CAGGCATGGGCCAGCGCGTCTGG - Intronic
947525131 2:230872955-230872977 CAGGCTGGGAGCTGCTGCTCTGG - Intronic
947839430 2:233198204-233198226 CAGGCTGTGGGCTGCTGGTCAGG - Exonic
948270902 2:236672340-236672362 CAGGCTTGGGGCAGATCCTCAGG - Intergenic
948547511 2:238743280-238743302 CAGGCTGGGAGCAGCTGCTGTGG + Intergenic
948791271 2:240378065-240378087 CAGGTGCGGGGCAGCTCGGCTGG - Intergenic
948805528 2:240452231-240452253 CAGGCTGGGGGCACCTGGGTGGG + Intronic
948981653 2:241497781-241497803 GAGGCTGGGAGCAGCCTGTCGGG + Intronic
949022094 2:241747206-241747228 CAGGCTGGGTGCAGCGGCTCAGG - Intronic
1170677650 20:18497202-18497224 CAGGCTGGGCTCAGCTCCGCTGG - Exonic
1171959321 20:31482575-31482597 CAGGGTAGGGGCAGCTTGGCAGG - Intronic
1172416466 20:34772753-34772775 AAGGCTGGGGGATGCACGTCAGG + Intronic
1173812996 20:45967880-45967902 GAGGCTGGGGGCAGCTGCACCGG + Exonic
1174869689 20:54171549-54171571 CAGGCTGGGGCCAGCTTTCCTGG - Intronic
1175333247 20:58178874-58178896 CTGGCTGGGGGCTGCTCTTGGGG + Intergenic
1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG + Intergenic
1179728565 21:43354416-43354438 CCTGCTGGGGGCAGCCCCTCTGG + Intergenic
1180081923 21:45491021-45491043 CAGGCTGGGGGCAGCGTGTGTGG + Intronic
1180599828 22:17008458-17008480 CAGCCTGGGTGCATCTCATCGGG + Intergenic
1180817837 22:18803336-18803358 GAGGCTGGGGGCAGCTCACAGGG - Intergenic
1181204052 22:21237789-21237811 AAGGCTGGGGGCAGCTCACAGGG - Intergenic
1182554225 22:31120328-31120350 CAGGCTGGGGGCAGCTGTCAGGG - Intergenic
1183406590 22:37633278-37633300 CAGGCTGGGGGAACCTCACCTGG + Exonic
1183489261 22:38108080-38108102 CAGCCTGGGAGCAGCCCGGCAGG + Intronic
1184497063 22:44848173-44848195 CAGGGTGGGGGCAGCTTCCCAGG + Intronic
1184616859 22:45644369-45644391 CAGGCTGGTGGGAGCTGGCCTGG + Intergenic
1185287772 22:50010273-50010295 CAGCCTGGGGTCAGCTCCGCCGG - Intronic
1203222869 22_KI270731v1_random:57626-57648 GAGGCTGGGGGCAGCTCACAGGG + Intergenic
1203267960 22_KI270734v1_random:29187-29209 AAGGCTGGGGGCAGCTCACAGGG - Intergenic
949893658 3:8752988-8753010 ATGGCTGGGAGCAGCTCCTCTGG + Exonic
950653290 3:14421180-14421202 CAGACTGGGGGCTGCTTCTCTGG - Intronic
952676712 3:36040621-36040643 GAGGCTGGGGGAAGCTTGTGGGG - Intergenic
952816162 3:37450060-37450082 CAGGCGTGCGGCATCTCGTCTGG + Intergenic
954390253 3:50264877-50264899 CAGGCTGAGGTCAGCCCTTCTGG - Intergenic
954633307 3:52058276-52058298 CAGGCTGGATGCTGCTTGTCAGG + Intergenic
954755891 3:52839608-52839630 CAAGCTTGGAGCAGCTGGTCTGG - Exonic
956212383 3:66815007-66815029 CAGGATGGGGGCTGGTCATCAGG - Intergenic
961202357 3:125055449-125055471 CAGGGTGGGGGCTCCTCGCCCGG - Intronic
961461989 3:127056446-127056468 CAGGCTGTGGGCAGCGCTTGTGG - Intergenic
967923799 3:194631462-194631484 CAGGCTTGGGCCAGCAGGTCAGG - Intronic
968553440 4:1235943-1235965 CAGGCTGGGTGCCGATCGTGTGG + Intronic
968628242 4:1637615-1637637 AGGGCTGGGGGCAGCCCGGCAGG + Intronic
968810870 4:2799183-2799205 CCGCCTGGGAGCAGCTCCTCCGG - Intronic
968894396 4:3390203-3390225 CAGGATGGGGGCAGGTGGTCAGG - Intronic
968915546 4:3495635-3495657 CAGGCTGGGGGCTCCTCCTCAGG + Intronic
969486573 4:7475533-7475555 CAGGAGGGGGGCAGCTGGGCTGG - Intronic
969598800 4:8163648-8163670 CAGGGTGGGGGCAGCAGGCCTGG - Intergenic
969697974 4:8746010-8746032 CAGGCTGGGGCCAGCGCTGCAGG + Intergenic
970824629 4:20255136-20255158 CCGGCAGGGGCCAGCGCGTCTGG + Intronic
971408390 4:26344030-26344052 CAGGCTGGGGGCAGTGGCTCAGG - Intronic
973703900 4:53563322-53563344 CAGGCTGGTGGCTGCTTGTATGG - Intronic
978593045 4:110346944-110346966 CAAGCTGGGGGCTGATGGTCAGG + Intergenic
981862180 4:149370036-149370058 CAGGCTGGGGCCACCACGTCTGG + Intergenic
982030288 4:151293779-151293801 CAGGCTGGGGTCAGATTGGCCGG - Intronic
982782392 4:159504937-159504959 CAGGCTGGGGGCATTTCAACTGG - Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
985318559 4:188683907-188683929 CAGGCTGCAGGCAGCACGGCTGG - Intergenic
985497737 5:218859-218881 CGGGCTGCGGGCTGCTCCTCAGG - Intronic
985588648 5:753614-753636 CAAGGTGGGGCCAGCTCCTCTGG - Intronic
985603317 5:846053-846075 CAAGGTGGGGCCAGCTCCTCTGG - Intronic
987027723 5:13944455-13944477 CAGGCTGGAGTCAGCTCTTCCGG + Exonic
987044169 5:14090946-14090968 CAGGCTGGGCTCAGCTGGCCTGG - Intergenic
989671133 5:43918135-43918157 CTGGCTGGGGGAGGGTCGTCTGG - Intergenic
991040004 5:62165371-62165393 CAGGCTGGGAGCCCCTCCTCAGG - Intergenic
992081253 5:73235421-73235443 CAGGCTTGGGCCACCACGTCTGG + Intergenic
995854231 5:116575756-116575778 CAGGCTTGTGCCAACTCGTCGGG + Intergenic
996762923 5:127003988-127004010 GAGGCTGGGGGCAGCCAGTGAGG + Intronic
997638725 5:135434693-135434715 CTGGCTGGGAGCAGCTCGCCAGG - Intergenic
998140904 5:139698913-139698935 CAGGCAGGCGGGAGCTGGTCAGG - Intergenic
998891569 5:146751771-146751793 GAGGGTGGGGGCAGGTCTTCTGG + Intronic
999372431 5:151064088-151064110 CAGGCTGTGGGTAGCCCGTAGGG - Intronic
1000288656 5:159849446-159849468 CAGGTGGGGGGCAGCTTGTTGGG - Intergenic
1002073709 5:176695956-176695978 CAGGATGGGGCCAGCCCGGCAGG + Intergenic
1002312330 5:178322579-178322601 CAGGCAGGAGCCAGCTCGTTTGG - Intronic
1002858167 6:1056337-1056359 CAGGCTTGAGCCACCTCGTCCGG - Intergenic
1003196628 6:3920538-3920560 CAGGATGGGGGCAGGTCTCCAGG + Intergenic
1006183592 6:32168138-32168160 CTGGCTGGGGGCAGGTTGCCTGG + Exonic
1006947434 6:37794240-37794262 CAGGCGTGAGGCACCTCGTCTGG - Intergenic
1007756635 6:44103765-44103787 CAGGCTCTGGGCATCTCCTCAGG + Intergenic
1010784131 6:79980409-79980431 CAGGCTGGTGGCACCTTGCCTGG + Intergenic
1019421419 7:952999-953021 CAGCCTGGGAGCAGCTTCTCTGG - Intronic
1019513884 7:1431389-1431411 GAGGGTGGGGGCAGCTGGTGGGG - Intronic
1019543143 7:1560387-1560409 CAGGATGGGGGGTGCTCGTCTGG + Intronic
1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG + Intronic
1020148928 7:5666685-5666707 CAGGCTGTGAGAAGCTCGGCAGG - Intronic
1021012982 7:15494537-15494559 CAGGCTGGGAGCAGCTTTACTGG - Intronic
1023771533 7:43561010-43561032 CTGGCAGGGAGCAGCTAGTCAGG + Intronic
1023820884 7:43979921-43979943 CAGGCATGAGGCAGCTCGCCCGG - Intergenic
1024127678 7:46317271-46317293 AAGTTTGGGGGCAGCTGGTCTGG - Intergenic
1024546859 7:50529625-50529647 CAGGCTGGGGGCAGTCCATGAGG - Intronic
1024578681 7:50784429-50784451 CAGGCTGGGAGCTGCTGGGCAGG - Intronic
1026333967 7:69378020-69378042 TAGGATGGGGGCAGCTATTCAGG + Intergenic
1028601093 7:92601343-92601365 CAGGCTTGCGGCACCGCGTCTGG - Intergenic
1029749158 7:102533358-102533380 CAGGCGTGAGGCAGCTCGCCCGG - Intergenic
1029767101 7:102632462-102632484 CAGGCGTGAGGCAGCTCGCCCGG - Intronic
1032094220 7:128929574-128929596 CAGGCTGGTGGCAGCTAATGGGG - Intergenic
1032464656 7:132136419-132136441 CAGGCCTGGGGCAGCTCGGAGGG - Intronic
1032836935 7:135683338-135683360 CAGGCTGGTGGCAGATATTCAGG - Intronic
1034966854 7:155396914-155396936 CTTGGTGGGGGCAGCTCGTGGGG + Intergenic
1035471896 7:159115724-159115746 GAGGCTGCAGGCAGCACGTCAGG - Intronic
1035566356 8:643733-643755 CAGGCATGGGGCGGCTCCTCAGG + Intronic
1037828993 8:22177251-22177273 CAGGCTGTGGGCAGCGCTGCGGG - Intronic
1038013473 8:23493735-23493757 CAGGATGGGGGCTGCTGATCTGG + Intergenic
1040059748 8:43093805-43093827 CAGGCTGGAGCCACCTCGCCGGG - Intronic
1042246349 8:66712614-66712636 CGGGCCGGGGGCAGCCCGTGCGG - Intronic
1042379402 8:68095324-68095346 CAGGATGGGGGCTGGTTGTCAGG - Intronic
1048222885 8:132559848-132559870 CAGGCTGGGTCCACCTCGGCTGG + Intergenic
1049717314 8:144099096-144099118 CAGGCTGGAGGCAGCTGGCTGGG + Exonic
1052982115 9:34457604-34457626 CAGGCTGGGGGCATCTAAACCGG - Intronic
1055147032 9:72948386-72948408 CAGGCTGGGGCCAGATCGGCTGG - Intronic
1057075643 9:92136856-92136878 CAGGCTTCGGGCATGTCGTCAGG - Intergenic
1057815327 9:98290054-98290076 AAGGCTGGGGTCAGCTGGCCTGG + Exonic
1058013536 9:100004329-100004351 AGGGCTGTGGGCAGCTGGTCTGG + Intronic
1058976248 9:110127713-110127735 CAGGCTGGCTGCACCTCCTCTGG - Intronic
1060812901 9:126619829-126619851 CAGGCTGGGAGGATCTCCTCTGG + Intronic
1061396985 9:130348716-130348738 TAGGCTGGGGACAGGTCTTCTGG + Intronic
1061513770 9:131076650-131076672 CAGGATGTGGACAGCTGGTCAGG + Intronic
1061925392 9:133803725-133803747 CAGGGTCCTGGCAGCTCGTCGGG - Intronic
1061958691 9:133977101-133977123 CAGGCTTGGGGCAGGGCGGCTGG - Intronic
1062173388 9:135147754-135147776 CAGGCGGCGGGCAGGGCGTCAGG + Intergenic
1062350318 9:136135499-136135521 CATCCTGTGGGCAGCTGGTCGGG + Intergenic
1062360978 9:136187928-136187950 CGGAGTAGGGGCAGCTCGTCAGG - Intergenic
1190118217 X:47639382-47639404 CAGGCTGGAGGCAGGGTGTCAGG + Intronic
1194493134 X:94576429-94576451 CTGCCTGGGGGCAGATCATCAGG - Intergenic
1196621266 X:117827154-117827176 CAGGCTGGGTGCAGTTGTTCAGG - Intergenic
1197108361 X:122742926-122742948 CAGGCTGGGCACAGCACGTTGGG - Intergenic
1197183985 X:123565952-123565974 CAAGCTGTGGGAAGCTCTTCAGG + Intergenic
1200019352 X:153188806-153188828 CAGGGTGGGGGCAGATGGTGAGG + Intergenic
1200233842 X:154458892-154458914 CAGGCTGGGGACAGGTCGGGAGG - Intronic
1202576195 Y:26328537-26328559 CAGGCTGGGCGCAGCGGCTCAGG + Intergenic