ID: 1145040986

View in Genome Browser
Species Human (GRCh38)
Location 17:19578437-19578459
Sequence CTTTGGGAGGGCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270098
Summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145040986_1145040997 18 Left 1145040986 17:19578437-19578459 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 1145040997 17:19578478-19578500 GAGCCACCACGACTGGCCAGAGG 0: 1
1: 17
2: 243
3: 955
4: 2618
1145040986_1145040993 -8 Left 1145040986 17:19578437-19578459 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 1145040993 17:19578452-19578474 TCCCAAAGTGTTGGGATTATAGG 0: 2339
1: 52139
2: 339839
3: 240187
4: 123501
1145040986_1145040996 11 Left 1145040986 17:19578437-19578459 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 1145040996 17:19578471-19578493 TAGGCATGAGCCACCACGACTGG 0: 7
1: 699
2: 11164
3: 57062
4: 144601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145040986 Original CRISPR CTTTGGGAGGGCAAGGTGGA AGG (reversed) Exonic
Too many off-targets to display for this crispr