ID: 1145045761

View in Genome Browser
Species Human (GRCh38)
Location 17:19614325-19614347
Sequence TGATCCAAGGGCAGAAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145045761_1145045767 18 Left 1145045761 17:19614325-19614347 CCTGCGTTTCTGCCCTTGGATCA No data
Right 1145045767 17:19614366-19614388 TCCCTCTTCCAGAAGCTGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145045761 Original CRISPR TGATCCAAGGGCAGAAACGC AGG (reversed) Intergenic