ID: 1145045924

View in Genome Browser
Species Human (GRCh38)
Location 17:19615824-19615846
Sequence GTGGGCAATGCTCTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 315}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145045914_1145045924 8 Left 1145045914 17:19615793-19615815 CCTGGGCCTTGGAGTTGCAGCCA 0: 1
1: 0
2: 2
3: 41
4: 332
Right 1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 315
1145045912_1145045924 10 Left 1145045912 17:19615791-19615813 CCCCTGGGCCTTGGAGTTGCAGC 0: 1
1: 0
2: 1
3: 16
4: 274
Right 1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 315
1145045913_1145045924 9 Left 1145045913 17:19615792-19615814 CCCTGGGCCTTGGAGTTGCAGCC 0: 1
1: 0
2: 1
3: 24
4: 355
Right 1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 315
1145045915_1145045924 2 Left 1145045915 17:19615799-19615821 CCTTGGAGTTGCAGCCAGCATCC 0: 1
1: 0
2: 1
3: 11
4: 199
Right 1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145045924 Original CRISPR GTGGGCAATGCTCTGGGGGA AGG Intergenic
900140036 1:1135970-1135992 GTGGGCAAGGCTGAGGGTGAGGG + Intergenic
900350884 1:2234039-2234061 TTGGGCCATGCTCTGGGGTCAGG + Intronic
901359023 1:8679611-8679633 TTGGGAAATCCTCTGAGGGAGGG - Intronic
901661250 1:10799255-10799277 GTGGGAAATGGTGTGCGGGAGGG - Intergenic
902395917 1:16132494-16132516 GTGGGCACAGATATGGGGGAAGG + Intronic
902983046 1:20139247-20139269 GTGGGCAGGGCTGTGGGGGAGGG + Intergenic
902988046 1:20167492-20167514 GTCGGCAATGCTGTGCGGGTAGG - Intronic
903157728 1:21459616-21459638 GGGGGCAAAGCTGTGGGGAACGG + Intronic
903260754 1:22130506-22130528 CTGGGCAAGCCCCTGGGGGAGGG - Intronic
903425659 1:23252419-23252441 GAGCCCAATGCTCTGGGAGATGG - Intergenic
903560700 1:24224857-24224879 GTGGGGGATGTTCTGAGGGATGG + Intergenic
903806033 1:26006155-26006177 GTGGGCAAGGCTGGAGGGGAGGG + Intergenic
903846184 1:26280928-26280950 GTGGGGTATGGGCTGGGGGACGG + Exonic
903884810 1:26535010-26535032 GTGGGGAAGGCTGTGGGGCAGGG + Intronic
903887810 1:26551173-26551195 GTGGGCACTGCTGTGAGGGGTGG + Intronic
904034162 1:27550145-27550167 GTGGGAGATGCTCTGGGTGTCGG + Exonic
904260132 1:29283377-29283399 GGGGGTAGTGCTCTGTGGGAAGG - Intronic
904315369 1:29656560-29656582 TTGGTAAATGCTTTGGGGGATGG - Intergenic
904390275 1:30180459-30180481 GTGGGAAATCCTGTGTGGGAGGG + Intergenic
904565262 1:31424906-31424928 GCGGGCAAGGCACTGGGGGAAGG - Intronic
904578538 1:31522584-31522606 GTGGGGACTGCTGTGGTGGAAGG + Intergenic
904604606 1:31691739-31691761 GTGGGCTCTGGTTTGGGGGAGGG - Intronic
904962791 1:34347842-34347864 GTGGGCAAGGCCATGGGGGGGGG + Intergenic
905234707 1:36538052-36538074 GCGAGCAGTGGTCTGGGGGAGGG - Intergenic
907115015 1:51960530-51960552 TTGGGCAACGGTGTGGGGGAAGG + Intronic
907266024 1:53261831-53261853 GTGAGAAGTGCTCTGGGAGAGGG + Intronic
909532801 1:76700128-76700150 GTGGCCCATGCTCTGGCAGAGGG + Intergenic
909548382 1:76871845-76871867 GTGGGAATTGGTCTGGGGAAAGG - Intronic
909667687 1:78153940-78153962 GTGGGCCCTGCTCTGGTGCAGGG + Intergenic
911017865 1:93353808-93353830 GTGGGCTTTTCTTTGGGGGAGGG - Intronic
911298789 1:96149178-96149200 GAGGGCCATACCCTGGGGGAGGG - Intergenic
911440522 1:97920822-97920844 GTGGGGAGTGCTCTGCGGGTAGG - Intronic
911943936 1:104082330-104082352 GAGGGTAATGCTCTGGCAGAGGG - Intergenic
912851868 1:113133290-113133312 CTGGCCAATGCTCTCAGGGATGG - Intergenic
912851934 1:113134194-113134216 CTGGCCAATGCTCTCAGGGATGG + Intergenic
913090709 1:115474913-115474935 GTGGGCAAGGGTGTGGGGCAGGG - Intergenic
913215622 1:116617720-116617742 GTGGGCTAGGCTCTGTGGTAGGG - Intronic
913553276 1:119937721-119937743 GTGGGCAGGGCTCTGGGGAAAGG - Intronic
914588562 1:149085042-149085064 GTGGGCAAAGCTGTGGGGAGCGG - Intronic
914747391 1:150510225-150510247 GAAGCCCATGCTCTGGGGGAAGG - Intronic
915737061 1:158091654-158091676 TTGGGCTCTGCTCTGAGGGAGGG + Intronic
918256256 1:182751099-182751121 GTGGGCTATGATATGGGGGCAGG + Intergenic
919762969 1:201110075-201110097 GTGGACTCTGTTCTGGGGGATGG - Intronic
920096329 1:203488671-203488693 GTGGGGAAGCCTCTGGGGGAGGG - Exonic
920816988 1:209343982-209344004 GTGGGAAATCCAGTGGGGGAGGG - Intergenic
923042617 1:230330601-230330623 GTGGGAAATTGCCTGGGGGAAGG - Intronic
1064242805 10:13646411-13646433 GTGGGGATGGCTATGGGGGAAGG - Exonic
1066045767 10:31594527-31594549 GAGGGCAATGCTCTGGTAGTTGG - Intergenic
1067061204 10:43078754-43078776 GGGGGCCAGGCTCTGGGGGCCGG + Intronic
1067347535 10:45447247-45447269 GTGGGAAATTCTCCGAGGGATGG - Intergenic
1067554578 10:47259640-47259662 CTGGGCAGGGCTCAGGGGGACGG + Intergenic
1068360239 10:55968150-55968172 GTATGCAATGGTGTGGGGGATGG - Intergenic
1069608542 10:69756868-69756890 GTAGACACTGCTCTGTGGGATGG + Intergenic
1070673044 10:78391578-78391600 GTGGGCAATGCTCTCTGAGTTGG + Intergenic
1070683084 10:78462722-78462744 GTGGACAATGCCGTGGAGGAAGG - Intergenic
1071220974 10:83464150-83464172 GAGGGCCATGCCCTGAGGGAGGG - Intergenic
1072446397 10:95502489-95502511 GGGGGAAATGCTCTGTGGCAGGG - Intronic
1072454076 10:95561144-95561166 TGGGGGGATGCTCTGGGGGAGGG + Intronic
1072619011 10:97067707-97067729 TGGGGCAAGGCTCTGGGGCAGGG - Intronic
1073045706 10:100637115-100637137 GTGGGGAATCTTCTGGGGGCAGG - Intergenic
1075083747 10:119400596-119400618 ATGGGCAGTGCTGTGGGGGTGGG + Intronic
1075217251 10:120546636-120546658 GAGGGCACTGCGTTGGGGGAAGG - Intronic
1076433936 10:130426700-130426722 GTGGGCAAGGACCTGGGTGAAGG + Intergenic
1076512737 10:131023958-131023980 GTGTGGAATGTTCTGGGGCAAGG - Intergenic
1077161088 11:1113193-1113215 GTGGGGCCTGCTCTGGGGAAGGG - Intergenic
1077161108 11:1113239-1113261 GTGGGGCCTGCTCTGGGGAAGGG - Intergenic
1077161128 11:1113285-1113307 GTGGGGCCTGCTCTGGGGAAGGG - Intergenic
1077161148 11:1113331-1113353 GTGGGGCCTGCTCTGGGGAAGGG - Intergenic
1077161168 11:1113377-1113399 GTGGGGCCTGCTCTGGGGAAGGG - Intergenic
1077161188 11:1113423-1113445 GTGGGGCCTGCTCTGGGGAAGGG - Intergenic
1078094585 11:8288992-8289014 GTGGTCCCGGCTCTGGGGGAAGG + Intergenic
1078569475 11:12444989-12445011 GTAGGCAGTGGTCTAGGGGAGGG + Intronic
1081724396 11:45317741-45317763 GAGGACACTGTTCTGGGGGAGGG + Intergenic
1083236342 11:61353254-61353276 GTGGGCAATGCCAGGTGGGAAGG - Intronic
1083723552 11:64616203-64616225 GTGGGCATGCCTCTGGGGGTTGG + Intronic
1084789973 11:71468394-71468416 TAGGGCAATGCTCTGTAGGAGGG + Intronic
1084959691 11:72710000-72710022 GAGGGCAAGGCTTTGGGGGCAGG + Intronic
1085517972 11:77122370-77122392 GTGGGTAAAGCTCTGGAGGCTGG + Intronic
1086523401 11:87697498-87697520 GAGGGGGAAGCTCTGGGGGATGG + Intergenic
1089346900 11:117796715-117796737 GAGGGCAAGGGGCTGGGGGAGGG + Intronic
1089703502 11:120260199-120260221 GGGAGCAATTCTCTGGGTGAGGG - Intronic
1089880228 11:121766329-121766351 GTGGGCAATGACGTGGGGGCCGG - Intergenic
1089980706 11:122769807-122769829 GTCGGCAATGAACTGGGGGATGG - Intronic
1090070971 11:123544656-123544678 GTGGGCAATGCTCAGTGACAGGG - Intronic
1090882518 11:130846476-130846498 CTGGGCAATGCAGTGGGAGAGGG + Intergenic
1092246999 12:6869273-6869295 GTGGCCCATGCTCTGGCAGAGGG + Exonic
1092472122 12:8789530-8789552 GAGGGCCATGCCCTGAGGGAGGG - Intergenic
1092938203 12:13383651-13383673 GTGGGCAGGGGTCTGGGGAATGG - Intronic
1095941885 12:47732807-47732829 GTGGGCAGTGTGCTGGGGCAGGG - Intergenic
1096030543 12:48410207-48410229 GTGAGCAAGGCTCTGTGGCATGG + Intergenic
1096263458 12:50106770-50106792 GGGGGCAAGGCTTTGAGGGAAGG - Intronic
1096996164 12:55839600-55839622 GTGGGCCATGCTCTGGGGCTTGG - Exonic
1098217638 12:68236942-68236964 GTGGGCAATGCAGTGGGAAACGG - Intergenic
1101966299 12:109284499-109284521 CTTGGCCATGCTCTGGTGGATGG + Intronic
1107664957 13:42679201-42679223 GTGGGTGAAGCTCTGGGGCAAGG + Intergenic
1107757568 13:43641336-43641358 GTGGACAAAACTCTGGGGCATGG - Intronic
1108000103 13:45897876-45897898 ATGGGGAATGCTTTGGGGCATGG + Intergenic
1109561166 13:64052434-64052456 GTGGGAAGTGCTCTAGTGGAGGG - Intergenic
1110228720 13:73146531-73146553 ATGGGCAAGGCTCTGTGGTAGGG + Intergenic
1112837480 13:103533787-103533809 GAGGGCAATTCTCTGGAGAAGGG - Intergenic
1113271251 13:108676943-108676965 GTTGGCAATGCTGCAGGGGAAGG - Intronic
1115806715 14:37060215-37060237 GTGGGCACTCCTCTGGAGGGAGG - Intronic
1117656528 14:57961718-57961740 GTGGGCAAAGATCCAGGGGATGG - Intronic
1121665189 14:95666741-95666763 GTGTGCAATGCAGTGTGGGAAGG + Intergenic
1122180319 14:99949886-99949908 TTGGGAAATGCTGTGGGAGAAGG + Intergenic
1122972989 14:105159808-105159830 GTGGACAGAGCTCTGGGGGGGGG - Intronic
1124619613 15:31266258-31266280 GTGTGCACTGCTCTGGGATAGGG - Intergenic
1124648968 15:31461046-31461068 GGGGCCAATGATCTGGTGGAAGG - Intergenic
1128245954 15:66132922-66132944 GCAGGCAATGCTCTTGGGGCTGG - Intronic
1128581338 15:68812321-68812343 GTGTGCAATGCACTGAAGGATGG + Intronic
1129035533 15:72646454-72646476 GGGGGCAATGCCCAGGGGGCAGG - Intergenic
1129214351 15:74090762-74090784 GGGGGCAATGCCCAGGGGGCAGG + Intergenic
1129466598 15:75727724-75727746 GTGGGTCCTGCTCTGGGTGAGGG + Intergenic
1129473250 15:75766706-75766728 GGGGGCAATGCTCAGGGGGCAGG + Intergenic
1129731493 15:77935112-77935134 GGGGGCAATGCCCAGGGGGCAGG + Intergenic
1130646348 15:85730598-85730620 GGGAGCAATCCTCTGGGAGAGGG - Exonic
1130905415 15:88236891-88236913 GTGGGGAACTTTCTGGGGGATGG + Intronic
1130905767 15:88240121-88240143 GGGGGCAATCCTGTGGGGGAGGG - Intronic
1131102766 15:89706221-89706243 GTAGGCAATGATCTGGGAAAAGG - Intronic
1131455208 15:92578349-92578371 TTTGGCAATGGTCAGGGGGATGG - Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1132411217 15:101579409-101579431 GCTGGAAGTGCTCTGGGGGAAGG + Intergenic
1132855287 16:2042230-2042252 TTGGGCAGGGCTGTGGGGGAAGG - Intronic
1132873124 16:2124373-2124395 GTGGGCAGAGCCCAGGGGGAGGG - Intronic
1133140915 16:3743461-3743483 ATGGACCATGCACTGGGGGAAGG - Intronic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134552213 16:15143554-15143576 GTGGGCAGAGCCCAGGGGGAGGG - Intergenic
1137404821 16:48181102-48181124 GAGGGCAACGCTCAGGGCGAAGG - Intronic
1137595365 16:49720083-49720105 GGGGGCAGTGCTCTGGGAGGTGG - Intronic
1137744056 16:50807902-50807924 GTGAGCCCTGCTCTGGGAGAAGG - Intergenic
1139540904 16:67615210-67615232 GTGGACACTGCTGTGGGGCAGGG - Intronic
1139572966 16:67824895-67824917 GTTAGCAAGGCTCTGGGGGAAGG - Intronic
1139597444 16:67966650-67966672 GTGGGCACTGAACTGGGGAAGGG + Intronic
1141255354 16:82397124-82397146 CTGGGCATTGCTCTGGGTGTAGG + Intergenic
1141619309 16:85228380-85228402 GAGGGCAAAGCTCTGGGGCCAGG + Intergenic
1142410785 16:89915571-89915593 GGGGACAGTGCTCTGGGGCAGGG + Intronic
1142682521 17:1558783-1558805 GAGGGCCATTCTCTGGGGGGGGG - Intronic
1143176100 17:4956044-4956066 CTGGGCAATCCTCTTGGGGTTGG - Exonic
1143515323 17:7416870-7416892 GAGGGCAAGGCTCTGAAGGAGGG - Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1144328739 17:14206072-14206094 TTGTGCCAGGCTCTGGGGGATGG + Intronic
1144584208 17:16478075-16478097 CTGGGCCATGCTCTGAGGGAGGG - Intronic
1144733690 17:17542983-17543005 GGAGGCCATGCTCTGGGGGAAGG - Intronic
1144771371 17:17761495-17761517 GTGGCCAGTGCCCCGGGGGATGG + Intronic
1144785057 17:17826925-17826947 GTGGACAAGGCTGTGGGGGCAGG - Intronic
1144898800 17:18564208-18564230 GGCGGCAGTGCTCTGGGGAAGGG - Intergenic
1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG + Intergenic
1146115828 17:30138010-30138032 CTGGGCAGGGCACTGGGGGAAGG - Intronic
1147438529 17:40432473-40432495 GAGGGCAATGGACTGGAGGATGG - Intergenic
1147665870 17:42147675-42147697 GTGAGCAACTTTCTGGGGGATGG + Intronic
1148382127 17:47207458-47207480 GAAGGCAATGATCTGGGGCATGG + Intronic
1148476698 17:47933453-47933475 GTGGGCATTGCTGTAGGGGGTGG - Intergenic
1148481142 17:47960237-47960259 ATGGGCTTTGGTCTGGGGGATGG + Intergenic
1150333343 17:64312066-64312088 GTGTGCAAAGCACTGTGGGAAGG + Intergenic
1150445386 17:65224252-65224274 CTGGCCTATGCTCTGGGGGCTGG + Intronic
1151372792 17:73659516-73659538 ATGGGCAATTCTCTGAGGAAGGG - Intergenic
1151526856 17:74676052-74676074 CAGGGCAATGGTCTGGGGTAGGG + Intronic
1151898099 17:76993969-76993991 CAGGGCAAGGCCCTGGGGGAGGG - Intergenic
1152110369 17:78354394-78354416 ATGGGCAGTGGTCTGGAGGAGGG + Intergenic
1152442783 17:80319197-80319219 GTAGGCAGTGATCTGGGAGAGGG - Exonic
1152641822 17:81452452-81452474 TTGGGGGATTCTCTGGGGGAGGG + Intronic
1152690004 17:81713702-81713724 GTGGGAGAGGCCCTGGGGGAGGG - Intronic
1154481126 18:14825916-14825938 ATGGGGAATGCTCATGGGGAAGG + Intronic
1156459450 18:37313585-37313607 GTGGGACAGGCTCTGGGGCATGG - Intronic
1156501097 18:37558883-37558905 GTGGGAAATGCAGTGGGTGAAGG + Intronic
1157312870 18:46565360-46565382 GTTAGCAATGGTGTGGGGGAAGG - Intronic
1159004374 18:62999499-62999521 GGGCGCCATGCTCTGCGGGAGGG - Intergenic
1160667920 19:341923-341945 GTGGGGGCTGCCCTGGGGGAAGG - Intronic
1160917937 19:1506650-1506672 GTGGGCAGGGGTCTGTGGGATGG + Exonic
1161040541 19:2108818-2108840 GTGGCCCCTGCTCTGGGGGTGGG - Intronic
1161081120 19:2310641-2310663 GCGGGCAGAGGTCTGGGGGAAGG - Intronic
1161197450 19:2994863-2994885 GTGGGCAGTGAGCTGGGGTAGGG - Intronic
1161219066 19:3109642-3109664 CTGAGCAAAGCTCTGGGGAAGGG + Intronic
1162573966 19:11487882-11487904 GTGGGCAATGGGCTGGTGGCTGG - Exonic
1162737234 19:12753465-12753487 GTGGGCAGTGCTGTCGGGGTTGG - Intronic
1163197493 19:15733269-15733291 GGGGGCAAGGCTCTGTGGGAGGG + Intergenic
1163257823 19:16168255-16168277 CTGGGCAATCCTCTGGCGGAAGG + Exonic
1163355146 19:16805718-16805740 CTAGGCAAAGCTCTGGGGGTTGG - Intronic
1163466775 19:17472429-17472451 GTGCGCAATGCTCAGGAGTATGG - Intronic
1163695493 19:18761393-18761415 GTGGGGGATGCACTGGGGGTGGG + Intronic
1163696722 19:18768061-18768083 GTGGGCAAGGCTTTGGGCGGGGG + Intronic
1164698451 19:30264318-30264340 GGAGACAATGCTGTGGGGGAGGG + Intronic
1164870766 19:31640798-31640820 GGGGAGAATGCTCTGGAGGAAGG + Intergenic
1166440755 19:42812937-42812959 TTGGGCAAAGCTCTGGGGAAAGG + Intronic
1166460257 19:42981819-42981841 TTGGGCAAAGTTCTGGGGAAAGG + Intronic
1167390336 19:49190534-49190556 CTGGCCATGGCTCTGGGGGAAGG + Intronic
1167690223 19:50980538-50980560 GTGTGCAAAGACCTGGGGGACGG + Intronic
926104676 2:10142690-10142712 GTGTGCAATGGACTGGCGGAGGG - Intronic
927770499 2:25856778-25856800 CTGGGCAATCCTCTTGGGGTTGG + Intronic
927867647 2:26601401-26601423 CATGGCAATGCTGTGGGGGAAGG + Intronic
927885685 2:26717211-26717233 GTGGGCAGTGTTATGGGGGCAGG - Intronic
928169478 2:28994169-28994191 GTGGGCAATGCGGTGGCTGAGGG + Intronic
932907936 2:75774207-75774229 ATGGGCAAGGCTTTTGGGGATGG - Intergenic
937041007 2:118820646-118820668 GTGGTCACTGCTCTGGGGACAGG - Intergenic
937910621 2:127073865-127073887 GTGTGCAGTACTCTGGGGGAGGG + Intronic
939253491 2:139713924-139713946 GTGGGTAAGTCTCTGGGTGATGG + Intergenic
940208948 2:151236650-151236672 CTGTGCAATGTTTTGGGGGAGGG - Intergenic
940420799 2:153477892-153477914 GTGGGCCAAGCTCTGGGGGCAGG - Exonic
940748502 2:157597386-157597408 CTGGCCGCTGCTCTGGGGGAGGG - Intronic
940842009 2:158594594-158594616 CTGGGCAATTCTCTGTTGGATGG - Intronic
941243236 2:163068001-163068023 GAGGGCCATGCCCTGAGGGAGGG - Intergenic
941654233 2:168126110-168126132 GTGGGCAGGGCTCTTGGGCATGG - Intronic
941874248 2:170417361-170417383 CTGGGCACTGCTCTGGGTCAAGG - Intronic
943133574 2:183886764-183886786 GAGGCCCATGCCCTGGGGGAGGG - Intergenic
943564894 2:189505688-189505710 GTGGACAATGGATTGGGGGATGG + Intergenic
945017967 2:205539750-205539772 CTGTGCAATGACCTGGGGGAGGG - Intronic
945644681 2:212475936-212475958 GTGGGGAAAGGACTGGGGGAAGG - Intronic
946797350 2:223369916-223369938 GTGAACACTGCTCTGGGTGATGG - Intergenic
947142985 2:227036759-227036781 GTGGTAAGTGCTGTGGGGGAAGG + Intronic
947739728 2:232479605-232479627 CTGGGCGAGGCTTTGGGGGAGGG + Intergenic
1169796819 20:9471749-9471771 GTGGGCAAAGATATGGGGAAAGG + Intronic
1171067098 20:22027850-22027872 GTGAGCAATGCTCTGTGGCTGGG + Intergenic
1171387175 20:24778336-24778358 GTGTGCAAGGTTCTGGGGCAGGG + Intergenic
1172340475 20:34153760-34153782 GAGGGCCATACTCTGAGGGAGGG - Intergenic
1173173903 20:40749789-40749811 GAGGGCAAGGCTGTGGGAGAAGG + Intergenic
1173715922 20:45205774-45205796 GTAGGCAATGCTCTATGGAAGGG - Intergenic
1174193554 20:48757225-48757247 GAGGGCAGTGCTGTGGGGGATGG - Intronic
1174419046 20:50387540-50387562 CTGGGCAAGGCTCTGGGGACGGG - Intergenic
1174485640 20:50859523-50859545 GTGGCTGGTGCTCTGGGGGAGGG + Intronic
1174593893 20:51668116-51668138 GTGGGCGAGGGGCTGGGGGAGGG + Intronic
1175123719 20:56736256-56736278 GGGGACAATGATCGGGGGGAAGG - Intergenic
1175204912 20:57304059-57304081 GTGGGCACTGCTCTGGGCTGGGG - Intergenic
1176799478 21:13410699-13410721 ATGGGGAATGCTCATGGGGAAGG - Intergenic
1177346766 21:19883211-19883233 ATGGGCAATAGTGTGGGGGATGG + Intergenic
1178675805 21:34631021-34631043 GTGGGCAGTACTGTGGGGCAGGG - Intergenic
1181494337 22:23279524-23279546 GTGCGCTTTGCTCTGGGGGCAGG + Intronic
1182062424 22:27407626-27407648 GAGGGAAAAGCTCTGGGGTATGG - Intergenic
1182656623 22:31895423-31895445 GTGAGCACTGCGATGGGGGATGG - Intronic
1183062603 22:35345387-35345409 TTGGGCAATGGCCTGGGGCAGGG - Intronic
1185031694 22:48446947-48446969 GTGGGCAGTGCTCTGGGCTTGGG - Intergenic
1185039932 22:48498650-48498672 CTGGGCCATGCTCTGTGGCAGGG + Intronic
1185332218 22:50256882-50256904 GGGGGGATTGCACTGGGGGAGGG + Intronic
950202712 3:11056487-11056509 GTGAGCAATGGTCTGCAGGAGGG + Intergenic
952933279 3:38376086-38376108 GAGGGCATAGCTCTGAGGGAGGG - Intronic
953186224 3:40640734-40640756 GTGGCCCATGTTCTTGGGGAAGG - Intergenic
953366502 3:42350094-42350116 GTAGGAAAGGCTCTGGGGAAGGG - Intergenic
954412703 3:50377948-50377970 GTGGGCACATCTCCGGGGGAAGG + Intronic
954782966 3:53074045-53074067 GTGAGCCAGGCTCTGGGGGATGG + Intronic
958742901 3:98096193-98096215 GTGAGCAAGGCTCTGTGGGCAGG + Intergenic
961384920 3:126517911-126517933 GAGGACATTGCTCTGCGGGAGGG + Intergenic
961479704 3:127171888-127171910 ATAGGCCATGCTCTGGGAGAAGG + Intergenic
962355884 3:134694008-134694030 GTGGGCAATGCTCCTGGCCAAGG + Intronic
962612039 3:137085945-137085967 GTATGCAATGATTTGGGGGAAGG + Intergenic
963206628 3:142642951-142642973 GTGGGAAATGGACTGGGTGAAGG - Intronic
963703034 3:148650475-148650497 ATGGGCACTGCTTAGGGGGAGGG - Intergenic
966064382 3:175800259-175800281 GTGAGCAATGCTCTGGTATAAGG - Intronic
967257876 3:187611888-187611910 ATGGTCAATCCTCTGAGGGAAGG + Intergenic
967292612 3:187936054-187936076 GTGGGCAGTGGTATGGGGGAAGG - Intergenic
968443419 4:636089-636111 GTGGGCATTGCTCAGGGGAGAGG + Intronic
968585676 4:1414908-1414930 GCGGGCGCTGCTCTGGGGGGAGG - Intergenic
970237532 4:13973741-13973763 GTGGGCAGGGGTGTGGGGGATGG - Intergenic
970553073 4:17203593-17203615 TTAGGCAGTGCTCTAGGGGATGG + Intergenic
973772516 4:54219694-54219716 CTGGCCTAAGCTCTGGGGGATGG + Intronic
974839038 4:67281043-67281065 GAGGGCCATGCCCTGAGGGAAGG + Intergenic
976132344 4:81897980-81898002 GAGGGCAATTCTCTGGAGAAAGG - Intronic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
978113374 4:104989641-104989663 GTGGGTAATTCTCAGGAGGAAGG - Intergenic
979140106 4:117162204-117162226 GTGGGCACAGGTCTGGGGGGTGG - Intergenic
980933627 4:139205470-139205492 GTGGGCAGTTCTCTTGGAGAAGG + Intergenic
983046458 4:162992640-162992662 GTGGGCATTGTTCTAGGGGCTGG - Intergenic
985529382 5:424887-424909 GTGGGCAGGGCTCTGGGACAGGG - Intronic
985640194 5:1059976-1059998 GAGGGCACTGCCCTTGGGGAGGG + Intronic
985779617 5:1863380-1863402 GAGGGCTCTGCCCTGGGGGATGG + Intergenic
990007222 5:50957715-50957737 TTTGGCAATGTTCTGGGGGTGGG - Intergenic
990380732 5:55220417-55220439 GAAGGCATTGCCCTGGGGGAAGG + Exonic
992253311 5:74897178-74897200 GTGGGAAAGGCACTGTGGGAGGG - Intergenic
992271999 5:75074366-75074388 GTAGGGAATGCTATGGTGGAAGG - Intronic
994353415 5:98770543-98770565 GTGAGCAATGCACTCGCGGAGGG - Intronic
997512841 5:134465333-134465355 GTGGGCAGTATTCTGGAGGAGGG + Intergenic
998111270 5:139504599-139504621 GAGGGCCATACTCTGAGGGAGGG - Intergenic
998367387 5:141640024-141640046 GTGGTCAGGGGTCTGGGGGAGGG + Exonic
998402698 5:141856197-141856219 GTGGGAACTGCTCTGGGGTCTGG - Intronic
998507738 5:142685719-142685741 GTGCAGACTGCTCTGGGGGAAGG - Intronic
1000085030 5:157881281-157881303 GAGGGCCATGCCCTGAGGGAGGG - Intergenic
1002699089 5:181109908-181109930 GTAGGCATTGCCCTGGGGGAAGG - Intergenic
1003512092 6:6790179-6790201 GGGTGCAATGCTCTGGTGGGAGG + Intergenic
1003631689 6:7793353-7793375 GTGGCCAAGGGTTTGGGGGAAGG + Intronic
1003643932 6:7899051-7899073 GAGGGCAAAGGTCGGGGGGATGG + Intronic
1003818589 6:9869175-9869197 GTGGGGAATGCTGAGGGGCAGGG - Intronic
1004024181 6:11803248-11803270 GTGGGTGGTGCTGTGGGGGAGGG - Intronic
1006132285 6:31877004-31877026 CTGGGCACTGCTCCGGGGGCTGG - Intronic
1007261228 6:40564795-40564817 GTGGGCAATGCTGGGGAGGTAGG - Intronic
1007519566 6:42441121-42441143 GTTGGGATTGCACTGGGGGAGGG - Intronic
1007764902 6:44154586-44154608 GTGGGCAGGGCCCTGGGGGGCGG - Intronic
1007989228 6:46237996-46238018 TTGGGCCAGGCTCAGGGGGAAGG - Intronic
1008034959 6:46735525-46735547 GCGGGCCATGGTCTTGGGGAGGG - Intronic
1010056387 6:71570388-71570410 CTGAGGAATGCTCTGGGGAATGG - Intergenic
1011375225 6:86680037-86680059 GAGGGCCATACTCTGAGGGAGGG + Intergenic
1011567648 6:88694851-88694873 CTGGGCCATGCTGTGGTGGAAGG - Intronic
1015276030 6:131384122-131384144 GAGGGCACTGCTCTAGGGAAGGG + Intergenic
1020017751 7:4841399-4841421 GTGGACAGGGCTTTGGGGGAGGG - Intronic
1020116482 7:5479342-5479364 GTGGGGAATGTTCTGGAGGAAGG + Intronic
1020129577 7:5552184-5552206 GTGGGCAACGCCCTGATGGAAGG - Intronic
1020281712 7:6653337-6653359 CTGGGCAACGGCCTGGGGGAGGG + Exonic
1021510466 7:21427889-21427911 GCGGCCAATCCGCTGGGGGAAGG + Intergenic
1022643853 7:32212783-32212805 ATGGGCAAAGATCTGGGGGATGG - Intronic
1022736090 7:33077359-33077381 ATTGGAAAGGCTCTGGGGGACGG + Intergenic
1023225714 7:37966872-37966894 GTAGGCAATGCATTGGGGCAGGG - Intronic
1023502687 7:40866946-40866968 GTGGGCGCTTTTCTGGGGGAAGG + Intergenic
1023998505 7:45176597-45176619 GGGGGCATTGCTCAGTGGGAGGG + Intronic
1024085433 7:45888539-45888561 GTGGCCAGTGCTCTCTGGGAGGG - Exonic
1024870977 7:53961502-53961524 GAGGGCCATACCCTGGGGGAAGG + Intergenic
1025251970 7:57357461-57357483 CTGGGCAAGGCTCTGGGGACGGG + Intergenic
1029203425 7:98854301-98854323 ATGGGCAAAGATCTGGGGGCTGG + Intronic
1030117141 7:106070591-106070613 GTAGGCACTGCACTGGGGGAAGG - Intergenic
1035679090 8:1474738-1474760 GTTGGCAAGGCTATGGGGAAAGG + Intergenic
1040803240 8:51366708-51366730 GTGGGCAGTGCACAGGGAGAAGG + Intronic
1040969098 8:53114503-53114525 GTGGGCAGTGGGCTGGGGGCTGG - Intergenic
1041956052 8:63558982-63559004 GTGAGCAATACTCAGGGAGAAGG - Intergenic
1048035262 8:130671996-130672018 GTGTGGAAAGATCTGGGGGAAGG + Intergenic
1048294202 8:133202666-133202688 CTGGGCAGTGCGGTGGGGGAAGG + Intronic
1048423004 8:134295549-134295571 GTGGGCACTGCTGTGGGTGCCGG - Intergenic
1048873737 8:138820297-138820319 GTGGGGGATGCTCTTGGGCATGG + Intronic
1053351876 9:37418539-37418561 GTGTGCATTGCTTTGGGGGAGGG - Intergenic
1055018752 9:71646682-71646704 GTGGGCAGGGGTCGGGGGGAAGG + Intergenic
1055527022 9:77145211-77145233 GTGGGGAAGGCTGTAGGGGAAGG + Intergenic
1055529639 9:77171147-77171169 GTGGTCCAGGCTCTGGGGAAGGG + Intergenic
1055787103 9:79883276-79883298 GTGGGGAAGGCTCTGGGGAGAGG + Intergenic
1056419591 9:86410593-86410615 ATGTGCAGTGGTCTGGGGGAAGG + Intergenic
1058928714 9:109696770-109696792 GAGGGTAATTCTCTGGGGAAGGG - Intronic
1059465871 9:114468589-114468611 GAGGGCACTGCTCTGTGGGATGG + Intronic
1060638690 9:125220580-125220602 GTGTGGAATGTTCTTGGGGATGG - Exonic
1061163311 9:128908543-128908565 CTGGGCAATGCTGGGCGGGATGG - Exonic
1061452472 9:130675804-130675826 GTGTTCAGTGGTCTGGGGGAGGG + Intronic
1061940252 9:133880155-133880177 GTGGGCAAGGGGCTGGTGGAGGG - Intronic
1062052659 9:134455632-134455654 GTTGGGAATCCTCTGGGCGAGGG + Intergenic
1062715650 9:138008877-138008899 CTGGGCAATCCTCTATGGGACGG - Intronic
1186187600 X:7037122-7037144 TTGGGCAAAGTTCTGGGGAAAGG + Intergenic
1187034588 X:15524560-15524582 GTGGGCAAGGCTCTTTGGGAAGG + Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1192452425 X:71252651-71252673 GTGGGAGAGACTCTGGGGGATGG - Exonic
1192609648 X:72554704-72554726 GTGGGGCCTGCTGTGGGGGACGG - Intronic
1192989077 X:76429739-76429761 TTGGGAAATGCTCTGGAGGATGG + Exonic
1195552601 X:106185751-106185773 GAGGGCCATGCCCTGAGGGAGGG + Intronic
1198178122 X:134175052-134175074 CTGGGCTGTGGTCTGGGGGAGGG - Intergenic
1199543949 X:148987444-148987466 GTGGTGAATGCGCTGGGGAATGG - Exonic
1199832620 X:151560873-151560895 GAGGGCCATGCCCTGAGGGAGGG + Intergenic
1199969010 X:152844837-152844859 GTGGGCAAGGCTTTGGTGCAAGG + Intronic
1200059522 X:153478046-153478068 GTGGGCAAGGCTTGGGTGGAGGG - Intronic
1200117835 X:153776939-153776961 CTGGGCCAGGCTCTGGGAGATGG - Exonic
1200691094 Y:6306687-6306709 CTGGGAAATGCCCTGGAGGAAGG + Intergenic
1201044178 Y:9868029-9868051 CTGGGAAATGCCCTGGAGGAAGG - Intergenic
1202115437 Y:21466519-21466541 TTGGGAAATGCCCTGGAGGAAGG - Intergenic