ID: 1145050953

View in Genome Browser
Species Human (GRCh38)
Location 17:19660140-19660162
Sequence AGGGCCTCTGCCTCCCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145050953 Original CRISPR AGGGCCTCTGCCTCCCTTTG AGG Intronic
900149598 1:1172261-1172283 ATGGCCTCTGCCCCCCTGAGAGG - Intergenic
900693464 1:3995661-3995683 GGGGCCACTGCCACCCTGTGGGG + Intergenic
901090215 1:6635925-6635947 AGGGCCCCAGCCCCCCTTTTAGG + Intronic
901210038 1:7519489-7519511 AGGGCTTCTGCCAGGCTTTGTGG + Intronic
904771021 1:32881503-32881525 GGGGCCTCAGCCTCCTTTGGTGG + Intergenic
905011543 1:34750510-34750532 TGGGCCTCTGCCTACATATGAGG - Intronic
905235035 1:36540340-36540362 AGAGCCTCTGCTTCCCATAGTGG - Intergenic
905983142 1:42250377-42250399 GGAGACTCTGCTTCCCTTTGGGG - Intronic
906323434 1:44830213-44830235 CAGGCCTCTGCTTCCCCTTGGGG - Intronic
906533796 1:46540008-46540030 AGGGGCTCAGCCTCCCATGGAGG - Intergenic
906687093 1:47769745-47769767 AGGGCCTCTTCCCCACTTTGGGG - Intronic
907492346 1:54816177-54816199 AGGGGCTCTCCCGCCCTGTGGGG - Intronic
907640558 1:56184844-56184866 CGAGCCTCTGCCTCCCACTGAGG - Intergenic
908444864 1:64190795-64190817 TGGGCCCCTGCCTCCATTTAGGG - Intergenic
910760264 1:90725767-90725789 AAGGCCTCTGCACCCCCTTGGGG + Intergenic
915523185 1:156460285-156460307 GGGGCCTCTGCCTACCTCTTCGG + Intergenic
916624467 1:166540156-166540178 AGGGCATCAGACTCTCTTTGGGG - Intergenic
916876097 1:168971164-168971186 TTGGCCTCGGCCTCGCTTTGAGG + Intergenic
917513472 1:175687741-175687763 AGGGCATCTGCCTCACATTGTGG - Intronic
918137443 1:181686915-181686937 AGGATCTCTGCCTGTCTTTGAGG - Intronic
922669468 1:227497889-227497911 AGGGCCTATGCCTTGCTTTTTGG + Intergenic
922670125 1:227503413-227503435 AGGGCCTATGCCTTGCTTTTTGG - Intergenic
922696498 1:227733580-227733602 AGGGCCTCTTCCTGCCCTGGGGG + Exonic
1063381550 10:5589120-5589142 AGGGCCTCTGGCTGGCTCTGCGG + Intergenic
1063642308 10:7842046-7842068 AGGGCCTCTGCCTCCCACATCGG - Intronic
1064397582 10:14993869-14993891 AGGGCCCCTTCCTCCTTTTCCGG + Intergenic
1069848521 10:71390166-71390188 GGGCCCTCTGCCTCTCTCTGGGG - Intergenic
1071334241 10:84588605-84588627 AGGGCCTCCCACTCCCTCTGAGG - Intergenic
1073094782 10:100972861-100972883 TGTGACTCTGGCTCCCTTTGGGG + Exonic
1074833120 10:117263728-117263750 AGGGCTTCAGTTTCCCTTTGGGG - Intronic
1076883012 10:133248603-133248625 AGGGTGTCTGCCTGCCTGTGTGG - Intergenic
1077081087 11:725037-725059 GGGGTCTCTGCATGCCTTTGGGG - Intronic
1077318700 11:1930437-1930459 GGGGCCCCTGCTCCCCTTTGGGG + Intronic
1077553472 11:3214609-3214631 AGGCCCTCTCCCTCCCCTTTGGG - Intergenic
1078053256 11:7985539-7985561 AGGGCCCTGGCCTCCCTTTTGGG - Intronic
1078115268 11:8442479-8442501 CTGGCCTCTGCATCCCTATGAGG - Intronic
1078440064 11:11357362-11357384 AGTCCCTCTGCCTCCCTTTCTGG + Intronic
1078440072 11:11357404-11357426 AGTCCCTCTGCCTCCCTTTCTGG + Intronic
1078829997 11:14969765-14969787 GGGACCTCTGTCTCCCTTGGAGG + Intronic
1078852007 11:15172539-15172561 AGGGCCTCTGCATCCTTCAGTGG - Intronic
1080944345 11:36954287-36954309 AGGTCCTTTGCCTCACTTTGAGG + Intergenic
1083366093 11:62142248-62142270 AGGGCTTCTGCCTCCAGTTGAGG + Intronic
1084497753 11:69514872-69514894 AGGGCCTCTGCCTTCCTCACTGG - Intergenic
1085692276 11:78673485-78673507 AGGCCCTCTGGATCCCTGTGTGG + Intronic
1087891687 11:103543635-103543657 TGGGCAGCTGCCTCCATTTGGGG + Intergenic
1088740863 11:112765775-112765797 AGAGCCTTTGGCTTCCTTTGTGG - Intergenic
1088807207 11:113363492-113363514 AGGGCCTTTTCCTCCCTTTTTGG + Intronic
1089611391 11:119671430-119671452 GGGGGCTCTGCATGCCTTTGGGG + Intronic
1090854963 11:130603088-130603110 AGGGACCCTGGCTGCCTTTGGGG + Intergenic
1091144062 11:133261911-133261933 TCAGCCTCTGCCTGCCTTTGAGG + Intronic
1091398490 12:168993-169015 CGGGCCTCTGCATTCCTTAGGGG + Exonic
1095794059 12:46197599-46197621 AGGGCTTCTGCCTCCTTTCAAGG + Intronic
1096741585 12:53697464-53697486 AGGGCCTCAGCTTCCTTCTGCGG + Intergenic
1096790648 12:54042671-54042693 AGGGCCCCTGAAGCCCTTTGAGG + Intronic
1097223778 12:57465150-57465172 AGGGCCCTCGCCTTCCTTTGGGG + Exonic
1101493800 12:105235430-105235452 AGGCCCTCTGCCTCTCATTCTGG + Intronic
1101777195 12:107806004-107806026 AGGGCCCCTGCCTGCCTTCTAGG - Intergenic
1102529835 12:113538095-113538117 AGGGACTCAGCCTCCCTGAGTGG + Intergenic
1105059583 12:133136489-133136511 AGGTTCTCTGCCTCCTTTTTGGG + Intronic
1106545567 13:30727975-30727997 AGGGCCTCAACCTACCTTTTGGG - Intronic
1106975613 13:35209284-35209306 GGGAGCTCTGCCTCCCTTAGGGG - Intronic
1107036017 13:35903310-35903332 AGTGCCTCTGCCTCCTCTTATGG - Intronic
1107323203 13:39211336-39211358 AGGGCCTGTGCACCCCTTTAGGG + Intergenic
1107460747 13:40599688-40599710 AGGGGCACTCCCTCCCTTTGAGG - Intronic
1107914086 13:45131606-45131628 TGGTCCTCTGCCTCTCTTTATGG - Intronic
1113746491 13:112748917-112748939 ACAGCCACTGCCGCCCTTTGCGG + Intronic
1114209644 14:20604084-20604106 TGGGCAGCTGCCTCCATTTGGGG - Intronic
1114387264 14:22268146-22268168 AGGGATTCTGTTTCCCTTTGAGG + Intergenic
1115496659 14:34011583-34011605 AGGCCCACTGCCTCCTTTTGGGG - Intronic
1116492886 14:45526895-45526917 AGGGCTCCTGCCTCGCTGTGGGG + Intergenic
1117301772 14:54437173-54437195 AGGGACTCTGCACCACTTTGTGG + Intronic
1118696508 14:68391538-68391560 AGGACCTCAGCCTGCCCTTGTGG - Intronic
1119319441 14:73720898-73720920 AGGGACTCTGGCTCTCTTAGGGG + Intronic
1121096197 14:91219701-91219723 AGGGCCTCTCCCTCACTTTAAGG - Intronic
1122953986 14:105061424-105061446 GGAGCCTCTGCCTCCCCTCGGGG + Intronic
1122985547 14:105209978-105210000 AGGTCCTCTGCCTCCAGCTGTGG - Exonic
1124233664 15:27968302-27968324 TGTGCCTCTGACCCCCTTTGTGG - Intronic
1124430615 15:29604852-29604874 AAGGGCTCTTCCACCCTTTGGGG - Intergenic
1124800637 15:32829540-32829562 AGAGCCCGTGCCTTCCTTTGAGG + Intronic
1125265172 15:37870731-37870753 ATGACCTTTACCTCCCTTTGAGG + Intergenic
1125403743 15:39331783-39331805 AGAGCCTCTGTCTCCCTGTATGG - Intergenic
1126778830 15:52120844-52120866 AGGGCCTCTGCCTTCCTCCAGGG - Exonic
1128479186 15:68022759-68022781 AGGGCCTCAGCCAACCTTGGGGG + Intergenic
1129929665 15:79399889-79399911 AGGGCCTCTTCCTCTCCGTGAGG + Intronic
1130274052 15:82467376-82467398 AGGGCCTCAGCTTCCATTGGTGG - Intergenic
1130466400 15:84194750-84194772 AGGGCCTCAGCTTCCATTGGTGG - Intergenic
1130497864 15:84478786-84478808 AGGGCCTCAGCTTCCATTGGTGG + Intergenic
1130588694 15:85199343-85199365 AGGGCCTCAGCTTCCATTGGTGG - Intergenic
1131581259 15:93645920-93645942 AGGGCCTTAGCTTCCCTTTAGGG + Intergenic
1132761676 16:1511476-1511498 GGGGCCTCTGCCTCCCCAGGAGG - Intronic
1132856234 16:2046113-2046135 GGGGCCCCTGCCTACCTTTGGGG + Exonic
1132997214 16:2829608-2829630 AGGCCCTCTGCCTCCCATCGTGG + Intergenic
1134274748 16:12766144-12766166 CCCGCCTCTGCCTCCCTTTGGGG - Intronic
1134395174 16:13855881-13855903 AGGGCTTCTGCCTCTCTTTGTGG - Intergenic
1137057865 16:35754016-35754038 ACTGCCTATGCCTCCCATTGCGG + Intergenic
1138135222 16:54515674-54515696 AGTGCCTCTGCATCCCTTGGTGG - Intergenic
1139327921 16:66166410-66166432 GGGTCTCCTGCCTCCCTTTGTGG + Intergenic
1142168269 16:88605308-88605330 GTGGCCTCTGCATGCCTTTGGGG + Intronic
1142221246 16:88856337-88856359 GCAGCCTCTTCCTCCCTTTGGGG + Intronic
1142235496 16:88920703-88920725 GCGGCCTCTGCCTCCCCGTGGGG + Intronic
1142288032 16:89179414-89179436 AGAGCCTCTGCCTGTCTTTGGGG + Exonic
1142486115 17:248538-248560 TGGGGCTCTGCCAGCCTTTGGGG - Intronic
1143092533 17:4457583-4457605 TGGGCCCCAGCCTCCCTGTGAGG - Intronic
1143541336 17:7571255-7571277 TGGGACCCTGGCTCCCTTTGGGG + Intronic
1144619986 17:16812392-16812414 AGGGCGCCTGCCCCGCTTTGGGG - Intergenic
1145050953 17:19660140-19660162 AGGGCCTCTGCCTCCCTTTGAGG + Intronic
1145275016 17:21424016-21424038 ATGGCCTCTGCCTCCCTGGCTGG + Intergenic
1145312868 17:21709916-21709938 ATGGCCTCTGCCTCCCTGGCTGG + Intergenic
1145796381 17:27657750-27657772 AGGGCACCTGCCCCACTTTGGGG + Intergenic
1146287892 17:31586680-31586702 AGGTACTCTGCCTCCCTGAGTGG + Intergenic
1147399353 17:40170553-40170575 AGGACCCCTGCCTTCCTCTGAGG + Exonic
1148077767 17:44948961-44948983 AGGGTCTCTTCCTCCCTTACTGG + Intergenic
1148156736 17:45429046-45429068 CAGGCGTCTGCTTCCCTTTGAGG - Intronic
1148681066 17:49473733-49473755 AGGACCTGTGCCTCCCCGTGGGG - Intronic
1148737745 17:49874348-49874370 AGGGGCTCGGGCTTCCTTTGGGG + Intergenic
1149441485 17:56678212-56678234 AGGGCCTCTGCCAGCCTACGGGG - Intergenic
1150388459 17:64777851-64777873 CAGGCGTCTGCTTCCCTTTGAGG - Intergenic
1150438518 17:65172766-65172788 AGGGGCTCTGCGTCCGGTTGGGG + Intronic
1150657778 17:67051595-67051617 AGGCCCCCTCCCTCCATTTGAGG + Intronic
1150791008 17:68200122-68200144 CAGGCGTCTGCTTCCCTTTGAGG + Intergenic
1151723773 17:75873262-75873284 AGAGCCTCTGCCTCTCTTCTGGG - Intergenic
1151876657 17:76870787-76870809 AGGACCCCAGCCTGCCTTTGAGG - Intronic
1151887317 17:76930803-76930825 GTGGACTGTGCCTCCCTTTGTGG - Intronic
1151954156 17:77372458-77372480 AGGGCTTCTCCCTCCCTTCTGGG - Intronic
1152394810 17:80025878-80025900 GGGGCCACTGCTTCCCTGTGGGG - Intronic
1153095359 18:1395129-1395151 AGGGCATCTGCGTCTCTTTCTGG + Intergenic
1153332386 18:3887112-3887134 AGGGACTCTGGCTTCCTATGGGG - Intronic
1153882691 18:9434631-9434653 TGGGCCTGGGCCTGCCTTTGGGG + Intergenic
1156396567 18:36704786-36704808 AGGGCTGCTGGCTCCCTTTGAGG - Intronic
1157290664 18:46407186-46407208 AGGGCTTCTGCTCCCCTTTCTGG + Intronic
1157535883 18:48457076-48457098 AGGGCGTCAGCCTCCCTGGGGGG - Intergenic
1157600753 18:48891879-48891901 AGGTCCTCTGCCTCCCTGCCTGG - Intergenic
1157975263 18:52319761-52319783 GGGGCCTCAGCCTCCTTGTGGGG - Intergenic
1158881623 18:61784368-61784390 GGGGACTCTGCCTCTCTTAGGGG - Intergenic
1159691232 18:71490826-71490848 AGGACCTCTTCTTCCCTATGTGG - Intergenic
1159946181 18:74446372-74446394 CCGGCCTCTGCCTCCCACTGTGG + Intronic
1160134305 18:76259476-76259498 TGGGCCTCTGCATCCCTTCGAGG - Intronic
1162910306 19:13844368-13844390 AGGGCCTTTTCTTCCCTGTGGGG + Intergenic
1163369481 19:16893904-16893926 AAAGCCCCGGCCTCCCTTTGGGG - Intronic
1164467332 19:28498863-28498885 AAGGCATCTGCCTCCCCCTGTGG - Intergenic
1165128775 19:33619518-33619540 GGGGCCTCAGGCCCCCTTTGGGG + Intergenic
1165735022 19:38170343-38170365 CGTGCCTCTGCCTCCCATGGCGG + Intronic
1166267205 19:41691558-41691580 AGGGACTCTGCTGCCCTCTGGGG + Intronic
1166936296 19:46335160-46335182 AGAGCCCCTGCCTCCCTTAGGGG - Intronic
1167123483 19:47533026-47533048 GGGTCCTCTGCCTGCCTGTGTGG + Intronic
1168565301 19:57417354-57417376 AGGGACTATCCCTCCTTTTGTGG + Intronic
1168711089 19:58500343-58500365 AGGGCTTCTGCATCCCTGTAGGG - Exonic
925026416 2:610639-610661 AGGGCCTATTCCTGCCTCTGAGG - Intergenic
925308022 2:2863917-2863939 AGTGACGGTGCCTCCCTTTGTGG - Intergenic
925611814 2:5707328-5707350 GGGGCCTCTTCTTCCCCTTGAGG - Intergenic
925637083 2:5950974-5950996 CGGGCCTCTGCCCCCCTGTTTGG - Intergenic
925907628 2:8548659-8548681 AGCTGCTCTGCCTGCCTTTGTGG + Intergenic
926278440 2:11424623-11424645 AAAGCCACTGCTTCCCTTTGGGG - Intergenic
926302917 2:11617269-11617291 AGGGGCTCTGCCCTCCTCTGCGG - Intronic
926303154 2:11618372-11618394 AGGGGCTCTGCCCTCCTCTGCGG - Exonic
926449420 2:12984072-12984094 AGGGCATCTACCTCCCTCCGAGG - Intergenic
926962896 2:18378286-18378308 TTGGCCTTTGCCTCCCTTCGAGG - Intergenic
929557473 2:42934520-42934542 TGGGCCTCTACCTCCATGTGAGG + Intergenic
931537776 2:63298197-63298219 GGGGCCTATCCCTCCCCTTGGGG - Intronic
932112033 2:69010734-69010756 AGTGCCTCTGCCTCTCTTCCAGG - Intergenic
932126788 2:69151929-69151951 AGGCCCTGTTCTTCCCTTTGAGG - Intronic
932276188 2:70453952-70453974 AAGGCTCCTGCCTCCCTCTGTGG + Intronic
932349576 2:71021398-71021420 AGGGCCCCTTCCTCCCTGTCCGG - Intergenic
932708674 2:74046832-74046854 AGGGCCTCTGCCTCCTGGTGAGG + Exonic
936472893 2:112814481-112814503 AGGGCCTCTGCCTTCCTCCAGGG + Intergenic
937478568 2:122236708-122236730 GGGTCCTGTGCCTCCCTTGGAGG - Intergenic
938186989 2:129240522-129240544 AGAGCTTCAGCCTCCCTTTCTGG - Intergenic
938289073 2:130140054-130140076 GGGGCCTCTGGCTCCCTTCCAGG + Exonic
938467456 2:131532884-131532906 GGGGCCTCTGGCTCCCTTCCAGG - Exonic
939955804 2:148526930-148526952 AGCCCTTATGCCTCCCTTTGGGG - Intergenic
940851245 2:158689959-158689981 AGGGCCCTTCCCTCCCTTTGAGG - Intergenic
944944499 2:204667683-204667705 AGAGCCTCTGCCTTCCATGGGGG + Intronic
946090469 2:217218240-217218262 AGGCCCTCAGCCTCCTTTTTGGG - Intergenic
947182049 2:227420146-227420168 AGGGCCTTAGCCTCCATTTCTGG - Intergenic
948481094 2:238251070-238251092 AGGCCAGCTGCCTCCCCTTGTGG - Intronic
948845140 2:240679536-240679558 AATGCCTCAGCCTCCCCTTGGGG - Intronic
948848720 2:240695343-240695365 AATGCCTCAGCCTCCCCTTGGGG + Intronic
949067004 2:241997643-241997665 AGGTCCTCTGTCTCCGTTTGAGG + Intergenic
1171189991 20:23151930-23151952 AGGGTCTCTGCCTCTCTTCGTGG + Intergenic
1171305292 20:24100530-24100552 AGGGCCTCTTCCAGCATTTGAGG + Intergenic
1172588817 20:36103396-36103418 AGGGCCCCTCCCTCTATTTGTGG + Intronic
1173340362 20:42147748-42147770 GGAGCCTCTGTCTCCCTTAGTGG + Intronic
1173539167 20:43838501-43838523 AAGGCCTCTGCCCACCTTTGTGG + Intergenic
1173670871 20:44798057-44798079 AGGGCCTCTGCCCTCCTCTCTGG + Intronic
1174188505 20:48723497-48723519 AGGGCCTTAGACTCCCGTTGGGG - Intronic
1175476881 20:59282336-59282358 AGGTCCTCTCCTTTCCTTTGGGG - Intergenic
1175567683 20:59993882-59993904 AGCGCATTTGCCTCCCCTTGGGG + Intronic
1175976132 20:62711350-62711372 ATGACCTCTCCCTCCCTTTGAGG + Intronic
1178639355 21:34333765-34333787 AGGGCCACTGGCTCCCACTGTGG + Intergenic
1180098956 21:45575430-45575452 AGGGCCTCTCCCACCCGCTGGGG - Intergenic
1181108358 22:20587704-20587726 GGGGCCTCTGCCTCCCTTCCAGG + Intergenic
1181711825 22:24696058-24696080 CGGGCCCCTCCCTCCCTCTGGGG + Intergenic
1181769504 22:25115137-25115159 CGTGCCTCTTCCTGCCTTTGTGG - Intronic
1183947015 22:41332325-41332347 GGGGCCTCCGCCTCCCTAGGAGG + Intronic
1184157069 22:42674869-42674891 AGGGTGTTTGCCTCCCTGTGTGG + Intergenic
1184189959 22:42887933-42887955 ACAGCCTCTGCCTCACTTTCGGG + Intronic
1184790027 22:46694634-46694656 AGGGTCCCTGCCTTCCTGTGGGG + Intronic
1185154115 22:49183052-49183074 ATGGCCACTGCCCTCCTTTGAGG - Intergenic
1185213418 22:49584980-49585002 GTGGCCTCTTCCTCCCCTTGGGG - Intronic
1185237057 22:49720331-49720353 TCCACCTCTGCCTCCCTTTGTGG + Intergenic
949649064 3:6133812-6133834 AGTGCCTATCCCTCTCTTTGGGG - Intergenic
949908734 3:8882283-8882305 AGGTCATATGCCTCCCCTTGAGG - Intronic
950158204 3:10739603-10739625 TGTGCCTATGCCTGCCTTTGTGG - Intergenic
950501364 3:13365930-13365952 AGGGCCCCTGGCTCACCTTGAGG + Exonic
952404339 3:32992218-32992240 AGGACCTCTTCCTCCCCTTTGGG + Intergenic
954225159 3:49176521-49176543 ACTGCCCCTGCCTTCCTTTGGGG + Intergenic
954447069 3:50552538-50552560 AGGGGCTCTGCTGCTCTTTGAGG + Intergenic
954557666 3:51531038-51531060 AAAGCCACTGCTTCCCTTTGCGG + Intergenic
954712347 3:52511475-52511497 AGGGCCTCTGTCTCCCCATCTGG + Intronic
955390856 3:58521291-58521313 AGGGCCTCTGCAGCCCTTCAGGG + Intronic
961010591 3:123433195-123433217 TGGGGCCCTGCCTGCCTTTGTGG - Intronic
961719095 3:128880253-128880275 AGCGCCTCTCCCTGCCATTGAGG + Intronic
961823756 3:129588254-129588276 CGTGCCTCTGCCTCCCTTGCAGG + Intronic
962939536 3:140113289-140113311 AGGGTCTCTGCAGACCTTTGGGG - Intronic
962987487 3:140548730-140548752 ATGGCCTCTGCCTACCTCTCTGG - Intronic
963461197 3:145617015-145617037 AGGGGCTGTGCCTCACTGTGGGG + Intergenic
964426076 3:156555128-156555150 AGGGCCTTTGCCCGCCTTGGCGG - Exonic
968462635 4:732991-733013 AGGGCCTCTGCCAGCCACTGTGG + Intronic
968626737 4:1629257-1629279 ACAGCCTCGGCCTCCCTCTGTGG - Intronic
969518208 4:7660500-7660522 TGGGACTCTGCCTCCTTTGGGGG - Intronic
971384803 4:26132941-26132963 GGTAGCTCTGCCTCCCTTTGTGG + Intergenic
971424323 4:26501337-26501359 ACGGCCCCTGCCTCCCTCTGTGG + Intergenic
976679732 4:87743361-87743383 ATTGGCTCTGCTTCCCTTTGTGG - Intergenic
978857681 4:113411860-113411882 ACTTCCTCTGACTCCCTTTGGGG - Intergenic
985679517 5:1248666-1248688 ACCACCTCTGCCTCCCTTTGTGG - Intergenic
985695541 5:1338133-1338155 AGGCTCTCTGCTTCCGTTTGGGG - Intronic
985802609 5:2015068-2015090 AGGATCTCTGTCTCCCTTTTTGG - Intergenic
985882633 5:2651309-2651331 AGGTCCTCTGACTCCCTGAGAGG - Intergenic
990576341 5:57127012-57127034 ATGGCCTCTGTTTCCCATTGTGG - Intergenic
994796773 5:104312350-104312372 AGAGCCTCTTCCCCCATTTGTGG - Intergenic
996488409 5:124064152-124064174 AAGGACTTTGCATCCCTTTGGGG - Intergenic
998672228 5:144366968-144366990 ATGGCCTCTGCCTCCCTAAGAGG + Intronic
998672239 5:144367018-144367040 ATGACCTCTGCCTCCCTAAGAGG + Intronic
998878112 5:146620593-146620615 TGGGCCTCTACCTCCCACTGTGG + Intronic
999302136 5:150497798-150497820 AGGGCCTCGTCATCCCTTCGGGG - Intronic
999350984 5:150871580-150871602 AAGGCCCCAGACTCCCTTTGGGG + Intronic
1001338934 5:170825894-170825916 AGTGCCTCTACCTTCCTTTTGGG + Intergenic
1001915267 5:175555118-175555140 AGGTCCTTTGGGTCCCTTTGTGG - Intergenic
1005849800 6:29813029-29813051 AGGGCCAGGGCCTCTCTTTGGGG - Intergenic
1005854816 6:29852819-29852841 AGGGCCAGAGCCTCTCTTTGGGG - Intergenic
1006801253 6:36760971-36760993 AGTGCTTCTGCCTCCCAGTGTGG + Intronic
1008166994 6:48151023-48151045 AGGGCCTCTGCATTTCTCTGAGG + Intergenic
1013648948 6:112174313-112174335 TGGGCCTCTCCCTCCATGTGGGG - Intronic
1017453366 6:154575279-154575301 AGGGACTCTGCCTGCACTTGAGG + Intergenic
1018405073 6:163472051-163472073 AGGGGCACTGACTCCCTTTGCGG + Intronic
1018906651 6:168079676-168079698 AGGGACCCTGGCTCCCTTTAGGG + Intronic
1018924254 6:168195373-168195395 GGGTCCTCTGCCTCCCGGTGAGG + Intergenic
1019222034 6:170480497-170480519 AGGGCCTCTGAGTACCTTGGCGG + Intergenic
1019356539 7:582820-582842 AGGGCCTCTGCCGCCCGTCTGGG - Intronic
1019433565 7:1010662-1010684 GGGCCCTCTCCCTCCCTTGGGGG - Intronic
1019518864 7:1451697-1451719 AGGGCCTCAGTCTCCCTGTCTGG + Intronic
1021203887 7:17755860-17755882 AATGCCTTTGCCTCTCTTTGAGG + Intergenic
1021839945 7:24714246-24714268 ATGGAGTCTGCCTCCCTTCGAGG + Intronic
1022739208 7:33105443-33105465 AGGGCTTCTGGCTTGCTTTGTGG - Intronic
1023032377 7:36101776-36101798 AGGGCCTCTCCCTCTCCTTGAGG + Intergenic
1023833340 7:44053060-44053082 ATGCTCTCTGCCTGCCTTTGAGG + Intronic
1026182709 7:68056110-68056132 AGGGCTTATGTCTCCCTTTTGGG - Intergenic
1029075030 7:97928307-97928329 GGGGGCTCTGCCTGCATTTGGGG + Intergenic
1029404903 7:100368864-100368886 AAGCCCTCTGCATCCCTTTTGGG + Intronic
1029632666 7:101762829-101762851 AGGCCCTTTGCCCACCTTTGGGG + Intergenic
1029896755 7:103990809-103990831 AGTGCCTTTGCCTGCATTTGTGG + Intergenic
1030934059 7:115562633-115562655 AGGCCCTATGCCTATCTTTGTGG + Intergenic
1031557313 7:123193657-123193679 AAGTCCTCTTGCTCCCTTTGTGG + Intronic
1032787074 7:135209539-135209561 AGGGGTTCTGCTTCCCTTGGTGG - Intronic
1033221136 7:139526722-139526744 AGGGCCTCTGTCTACCTGAGAGG - Intronic
1035233637 7:157482902-157482924 TGAGCCTCTCTCTCCCTTTGGGG + Intergenic
1036590503 8:10163776-10163798 AGGGCCTGTGGCCCCCTTGGAGG - Intronic
1036820537 8:11936100-11936122 AGGAACTCTGTCTTCCTTTGGGG - Intergenic
1036899322 8:12659355-12659377 AGGGGCTCTGCCTGCACTTGGGG + Intergenic
1037789159 8:21920601-21920623 AGGGCCTGTGCCTGTCTTTGAGG - Intronic
1039201230 8:35095619-35095641 ATGGCCTGTGCCTACCTATGGGG + Intergenic
1039931849 8:41999362-41999384 ATTGCCTCTCCCTTCCTTTGTGG + Intronic
1042328092 8:67548929-67548951 AGGGACTGTGCATCCCTGTGGGG + Intronic
1043621014 8:82192394-82192416 GGGGCCTCAGCCACCCTGTGGGG - Intergenic
1044915582 8:97109770-97109792 ATGACCTCCGCCTCCCTTTCTGG + Intronic
1045782748 8:105886795-105886817 ATGGGCTCTGGCTCCCTGTGAGG - Intergenic
1047367262 8:124222818-124222840 AGGGCCTCAGACACCCTGTGGGG - Intergenic
1047402113 8:124556434-124556456 AGGGCCTCTGCCTCCACTGGAGG + Intronic
1047422600 8:124719418-124719440 AGGGCCTCTGATTCCCATTTAGG - Intronic
1047996588 8:130342516-130342538 TGGGCCTCTGCTTCCCTAGGGGG - Intronic
1048131157 8:131699236-131699258 AGAGTCTCGGCTTCCCTTTGGGG - Intergenic
1048184551 8:132227618-132227640 AGGGCCTCTTTGGCCCTTTGTGG + Intronic
1049099100 8:140566739-140566761 AGAGACTCTGTCTCCCTTTCTGG - Intronic
1049411038 8:142474158-142474180 AGGGGCCCTGCCTCCCTCAGTGG - Intronic
1050512861 9:6413227-6413249 ATGGCCTCTTCCTATCTTTGAGG + Intronic
1051025574 9:12606775-12606797 AGGACCTCTGCCTCTCCTTCAGG + Intergenic
1055991626 9:82112375-82112397 AGAGCCTCTGCATCCCTTTAAGG - Intergenic
1057453548 9:95187437-95187459 TGGGCCTCTGCATACATTTGTGG - Intronic
1057474705 9:95388586-95388608 TGGGCCTCTGCATACATTTGTGG + Intergenic
1058869569 9:109190598-109190620 AGGGCATCTGACCCGCTTTGAGG + Intronic
1059668415 9:116471427-116471449 AGGGCCTCTCCCTCCCCTTCAGG + Intronic
1060748974 9:126156297-126156319 AGGGGCTCTGACACCCTGTGTGG - Intergenic
1060813273 9:126622083-126622105 AGCCCCTCATCCTCCCTTTGGGG - Intronic
1061059178 9:128242177-128242199 AGGGCCTGAGCCTCCCCATGGGG - Intronic
1061216624 9:129225416-129225438 AGGGCCCCTGCTGCCCTATGAGG - Intergenic
1061286624 9:129626928-129626950 AGGGCCTCTGACACCAGTTGTGG - Intronic
1062710440 9:137972409-137972431 AGGGCCTCAGTCTCCCCTTGAGG + Intronic
1186031862 X:5376930-5376952 AAGGTCTCTGACTCCCTTGGAGG + Intergenic
1187560653 X:20399801-20399823 AGGGCCCCTGCTCCCCTTTCTGG + Intergenic
1189281052 X:39820572-39820594 AGGGCCTCTCCTTCACTTGGAGG - Intergenic
1189302673 X:39963805-39963827 ACCTCCTCTCCCTCCCTTTGTGG + Intergenic
1189614580 X:42770123-42770145 GGGGCCTCTGCCTCTCATTAGGG + Intergenic
1190159738 X:48022578-48022600 ACAGCCCCTGGCTCCCTTTGGGG - Intronic
1192510761 X:71719245-71719267 AGGGCCACGGCCTCGATTTGGGG + Intergenic
1192515936 X:71762308-71762330 AGGGCCACGGCCTCGATTTGGGG - Intergenic
1192545099 X:72006529-72006551 AAGGCATCTGCCTGCCTCTGAGG - Intergenic
1192694924 X:73403129-73403151 AGATCCACTGCTTCCCTTTGTGG - Intergenic
1194900025 X:99498246-99498268 AGTGGCTCTGCATCTCTTTGGGG + Intergenic
1196031517 X:111098672-111098694 AGCGCCTCCACTTCCCTTTGAGG - Intronic
1198228058 X:134664617-134664639 TGGGCCTCTGGCTCCCTTTCTGG - Intronic
1199502016 X:148517440-148517462 AGGGCATCTGGCTTTCTTTGTGG + Intronic