ID: 1145051540

View in Genome Browser
Species Human (GRCh38)
Location 17:19665876-19665898
Sequence ATGGAGCAACTGACTTAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145051540_1145051550 18 Left 1145051540 17:19665876-19665898 CCGTCCTAAGTCAGTTGCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1145051550 17:19665917-19665939 TTGGCAGGACCATCTGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 167
1145051540_1145051546 -1 Left 1145051540 17:19665876-19665898 CCGTCCTAAGTCAGTTGCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1145051546 17:19665898-19665920 TGGGATGCGATGGCCCAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 122
1145051540_1145051547 3 Left 1145051540 17:19665876-19665898 CCGTCCTAAGTCAGTTGCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1145051547 17:19665902-19665924 ATGCGATGGCCCAGTTTGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 57
1145051540_1145051551 24 Left 1145051540 17:19665876-19665898 CCGTCCTAAGTCAGTTGCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1145051551 17:19665923-19665945 GGACCATCTGTTCCTGGTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145051540 Original CRISPR ATGGAGCAACTGACTTAGGA CGG (reversed) Intronic
908549916 1:65198531-65198553 AGGGAGCTCCTGACATAGGAGGG + Intronic
912099407 1:106186885-106186907 CTGTAGCACCTGACTTAGGCTGG - Intergenic
917224537 1:172767394-172767416 AAGGAGCATCTGACTAAGAAAGG - Intergenic
918203438 1:182288498-182288520 AAGGAGCACCAGCCTTAGGATGG + Intergenic
920806121 1:209235535-209235557 ATGGAACAACTGGTTTAGGCTGG + Intergenic
924654062 1:245956867-245956889 GTGGATCAACTGCCTTAAGATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071318274 10:84424824-84424846 ACATAGCTACTGACTTAGGACGG - Intronic
1071808934 10:89156790-89156812 ACGGAGGAACTGGCTTAGGTAGG + Intergenic
1071878685 10:89870704-89870726 ATGGTGCATCTGAATTAGAAGGG - Intergenic
1072218650 10:93309153-93309175 TTGGAGGAACTGTCTTAGCAGGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1075828161 10:125378405-125378427 ATGAAGCAACTACCTTATGAAGG + Intergenic
1078952458 11:16149734-16149756 AATGAGCAAGTGACTTAGAAAGG + Intronic
1080538719 11:33246205-33246227 ATGGAGAAACTCATTTAGCAAGG - Intergenic
1086577543 11:88357434-88357456 AAAGAGAAACTGACTTAGGTAGG + Intergenic
1087611289 11:100436997-100437019 ATGTAGGAATTTACTTAGGATGG + Intergenic
1089302847 11:117508943-117508965 ATGGAGCAAGTTACTAAGGCAGG + Intronic
1091348403 11:134871983-134872005 AAGGATGAACTGACTCAGGATGG - Intergenic
1093573476 12:20696468-20696490 AGAGAGCAAGTGGCTTAGGAAGG - Intronic
1094816649 12:34193194-34193216 ATGGAACAACTGTCTTAGAACGG + Intergenic
1101005204 12:100395094-100395116 ATGGACCAACTGATTGTGGAAGG + Intronic
1102593241 12:113973351-113973373 GGGGACCAACTGACATAGGAAGG - Intergenic
1106785892 13:33107906-33107928 ATGGAGGACATGACTTAGTAAGG - Intronic
1106808279 13:33333635-33333657 GAGGAGGAACTCACTTAGGAGGG + Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1113190832 13:107743583-107743605 CTGTAGCAACTGACTCGGGAAGG - Intronic
1114791870 14:25668646-25668668 AGGAAGCAAGTGACTTAAGAGGG - Intergenic
1115505685 14:34092336-34092358 ATGGAGCCAATGACTGAGGGTGG - Intronic
1116043469 14:39714466-39714488 ATGGTGCCACTCACTGAGGAAGG + Intergenic
1117970661 14:61247795-61247817 ATAGAGCATCTGACTTATGGAGG + Intronic
1118536390 14:66771070-66771092 TTGGAGCCAGTGGCTTAGGAAGG - Intronic
1118726042 14:68629600-68629622 AAGGAGGAACTGGCTTGGGAGGG + Intronic
1118940475 14:70331953-70331975 ATGGAGCCAAAGACCTAGGAAGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119698382 14:76732855-76732877 ATGGAGGAAGGGACCTAGGAAGG - Intergenic
1121452985 14:94021226-94021248 ATAGAGGAACTGACTGAGGCTGG + Intergenic
1125733156 15:41905525-41905547 ATGGAGCCACAGACTTACGTGGG + Intronic
1126923783 15:53558762-53558784 ATGGAGCCAATGACTGAGGCTGG + Intronic
1128527737 15:68423862-68423884 AGGAAGCACCTGACTCAGGATGG - Intronic
1129902260 15:79160078-79160100 GTGGAGCGAATGACTTTGGAGGG + Intergenic
1130805180 15:87313539-87313561 GTGGTGCAACTGACCTTGGATGG + Intergenic
1136531296 16:30871188-30871210 AGCTAGAAACTGACTTAGGAGGG + Intronic
1136615528 16:31396041-31396063 CTGGAGCAGCTGACCTAGGTGGG - Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138534840 16:57654276-57654298 GTTGAACTACTGACTTAGGATGG - Intronic
1140552937 16:75887167-75887189 AAGGAGCAACAGCCTAAGGAAGG + Intergenic
1143041462 17:4040666-4040688 AAGGAGAAAATAACTTAGGAAGG + Intronic
1145051540 17:19665876-19665898 ATGGAGCAACTGACTTAGGACGG - Intronic
1148845873 17:50529505-50529527 GGGGAGCAACTGCCATAGGAGGG + Intronic
1148861451 17:50606392-50606414 CTGGAGCAGCTGACTTACCAGGG + Intronic
1149718907 17:58822908-58822930 ATGGCGCAACTGACTTTGGCAGG - Intronic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151419864 17:73990176-73990198 ATGGAACACCTGACTGGGGAAGG + Intergenic
1154103552 18:11499746-11499768 ATGGAGTGAATGACTTAGGCAGG - Intergenic
1154128267 18:11713555-11713577 CTGCAGCAACTGGCCTAGGATGG - Intronic
1156107643 18:33684969-33684991 ATGGTGCAAATGATTTTGGAAGG + Intronic
1160049312 18:75417236-75417258 AGGGAGCACCTGCCTCAGGAAGG + Intronic
1160119111 18:76111549-76111571 GTGGAGAGACTGACTTAGGATGG + Intergenic
1160235039 18:77078942-77078964 ATGGAGCCACAGTCTTGGGAGGG - Intronic
1161644243 19:5443513-5443535 AGGGAGCACCTGACTCAGGCTGG + Intergenic
1162716367 19:12636868-12636890 ATGGAGCAACACACTTGGGAAGG - Intronic
1167777095 19:51565382-51565404 ATGGAGCCCCTGACTTAGGTGGG + Intergenic
926383979 2:12317822-12317844 AGGGAGCCACGGACTTAGGTGGG + Intergenic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
934150811 2:89145966-89145988 ATGGAGCAACTCAGTTTGGCGGG - Intergenic
934216466 2:90036059-90036081 ATGGAGCAACTCAGTTTGGCGGG + Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
937729844 2:125215411-125215433 ATAGAGCAAATGACCTAGGTAGG + Intergenic
938943176 2:136187130-136187152 ATGGAGCAACTGGCTCAAGTAGG + Intergenic
942068524 2:172294386-172294408 ATGGAGCAGCTGACATGAGAGGG - Intergenic
944880604 2:204009031-204009053 ATGTAGCAAAAGCCTTAGGATGG - Intergenic
945194910 2:207228672-207228694 ATGGAGTAACTGAAGTAGGGAGG - Intergenic
1170974510 20:21149848-21149870 AAAGAGCAAGTGACTTAGGTTGG + Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1173028385 20:39331044-39331066 ATGAAGCAACTGACATCTGATGG + Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1175058663 20:56221349-56221371 ATGGAGCAGGTGACTCAGGAAGG - Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1177595136 21:23229733-23229755 ATAGAGCAACTGACTCTTGACGG + Intergenic
1178330952 21:31690661-31690683 ATGGAGATACTGACACAGGAGGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1181970607 22:26687087-26687109 ATGGAGCCATTGGCTTAAGATGG - Intergenic
950232190 3:11285624-11285646 GTGGAGCTACTGACTTGAGAAGG - Intronic
951408157 3:22326607-22326629 ATGGAGCATCTGTCTCAGGTGGG + Intronic
951746372 3:25982026-25982048 ATGGTTCAGCTGTCTTAGGAAGG + Intergenic
954616290 3:51970266-51970288 ACAGAGAAACTGACCTAGGAGGG - Intronic
957278869 3:78124600-78124622 ATTCAGCAACTGACAAAGGATGG + Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
960402217 3:117215046-117215068 ATTGATCAACTGAGTTAGGGGGG + Intergenic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961631815 3:128306785-128306807 ATGAGAAAACTGACTTAGGAAGG + Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965991166 3:174819934-174819956 ATGGAGAAATTGGATTAGGAAGG - Intronic
967670003 3:192221610-192221632 TTGGACGAAGTGACTTAGGAAGG + Intronic
970162946 4:13207796-13207818 ATGGAGCAGCTCATTTAGGTAGG + Intergenic
970252384 4:14129240-14129262 ATGGGGCCAGGGACTTAGGAAGG + Intergenic
973141473 4:46773942-46773964 ATGGAACAAGGGAATTAGGAGGG - Intronic
973649460 4:52983887-52983909 ATGGAGCATCTATCTTAAGAAGG - Intronic
976319799 4:83700579-83700601 AAGGAGCAAATGACTTATAAAGG - Intergenic
980603432 4:135057776-135057798 ATGGAGCAACTTAATAAGTAAGG - Intergenic
981046319 4:140268086-140268108 ATGGAGGAATTGATTTGGGATGG + Intronic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
982309825 4:153973327-153973349 CTGGGGAATCTGACTTAGGACGG - Intergenic
982987432 4:162228606-162228628 GTGAAGTGACTGACTTAGGACGG + Intergenic
985286534 4:188341835-188341857 TAGGAGAAACTGAGTTAGGACGG - Intergenic
988122894 5:26990945-26990967 ATGGGGCAATAGACTTAGGCAGG + Intronic
993125412 5:83829421-83829443 ATAGAGCAACTGACTTCAGGAGG - Intergenic
993705626 5:91166616-91166638 ATGGACCAAATGACTGAGGCTGG + Intergenic
994356630 5:98800551-98800573 ATGGAGCAAGTGACAGAGAAGGG + Intergenic
996767864 5:127052988-127053010 AGGGTGCACCTGACCTAGGAAGG - Intronic
997696541 5:135865580-135865602 ATGGAGCGCCTGACTTAGGCAGG - Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000563690 5:162822146-162822168 ATGGAGCAACTTACTTGCTAGGG - Intergenic
1004308255 6:14520806-14520828 ATAGAACAAATGACTTAGTAAGG - Intergenic
1004697008 6:18043212-18043234 ATGGAGCCTCTGACCTAGGCAGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008584324 6:52935169-52935191 ATGGAGCTACAGGGTTAGGAGGG + Intergenic
1010004811 6:70984053-70984075 TTTGATAAACTGACTTAGGAGGG + Intergenic
1010023758 6:71191937-71191959 ATAGACCAAGTGACTTATGAAGG + Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1014353700 6:120377020-120377042 AAGGAGCCACTGACCTAGGTTGG + Intergenic
1015705077 6:136079202-136079224 AGGGGGTCACTGACTTAGGAAGG - Intronic
1016234660 6:141848782-141848804 ATGTAGCACCTGACTTTGGAGGG - Intergenic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1017079548 6:150654519-150654541 AAGTAGCAACTGACCTGGGATGG - Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1023749529 7:43358444-43358466 ATCGAGAAAGTGACTCAGGAAGG + Intronic
1026100424 7:67379538-67379560 ATGGAGCAACAGAGATAGAAGGG + Intergenic
1026266159 7:68797738-68797760 ATGGGGAAACTGACTTTGGGAGG - Intergenic
1026501754 7:70948643-70948665 ATGGAGCAAGAGAGATAGGAGGG - Intergenic
1030628290 7:111867874-111867896 CTGGAGCAATTGACTTCTGATGG + Intronic
1031770189 7:125832549-125832571 ATGGGGCAACGGACCTAGGATGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038397197 8:27255611-27255633 ATGGGGCAAATAAATTAGGAAGG - Intronic
1043186197 8:77153410-77153432 ATGGAGTAACTGATTTGGAATGG + Intergenic
1043723200 8:83574367-83574389 ATTGAAAAACTGTCTTAGGATGG + Intergenic
1045317507 8:101056111-101056133 ATGAAGCAACTTATATAGGAAGG + Intergenic
1047694449 8:127389246-127389268 ATGCAGCTACTGAATTATGAAGG - Intergenic
1047825125 8:128565058-128565080 ATGGATTAACTAACTGAGGATGG + Intergenic
1048004091 8:130404621-130404643 GTGGAGCAGCTGAGTTAGTATGG + Intronic
1048620774 8:136130610-136130632 AGGGTGCAACTAACTTAGTAAGG - Intergenic
1049140721 8:140951346-140951368 ATGGCCCAACGGACTTACGAAGG + Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059694769 9:116720681-116720703 ATAGAGAAACTGACTATGGAAGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061415243 9:130444044-130444066 ATGGAGCAACTGCCTTGGATGGG + Intergenic
1062169622 9:135127685-135127707 ATCGAGCAACTGCCTTCGAATGG + Intergenic
1186730266 X:12402437-12402459 ATGGTGCAACTTACTGAGGTAGG - Intronic
1188369227 X:29348572-29348594 ATTTAGCAACTGATTTAGGAGGG + Intronic
1190262365 X:48805472-48805494 AAGGAGCAACTGATCCAGGAGGG + Exonic
1197211289 X:123830253-123830275 ATTGAGAAACTGACTTTGTATGG - Intergenic
1198500096 X:137235774-137235796 ATGGACCTACTGACCTGGGAGGG - Intergenic
1202592578 Y:26502417-26502439 ATAGAGCAAAAGACTTATGAGGG - Intergenic