ID: 1145056272

View in Genome Browser
Species Human (GRCh38)
Location 17:19706006-19706028
Sequence CTGGAAAGACAGACCACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 251}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145056272_1145056278 2 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056278 17:19706031-19706053 GAACTCAGGGTGGCAGTGTGAGG 0: 1
1: 0
2: 2
3: 37
4: 303
1145056272_1145056283 20 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056283 17:19706049-19706071 TGAGGGAGGGGACAGAGAACAGG 0: 1
1: 0
2: 7
3: 97
4: 877
1145056272_1145056284 26 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056284 17:19706055-19706077 AGGGGACAGAGAACAGGACCAGG 0: 1
1: 0
2: 4
3: 59
4: 623
1145056272_1145056285 27 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056285 17:19706056-19706078 GGGGACAGAGAACAGGACCAGGG 0: 1
1: 0
2: 3
3: 46
4: 481
1145056272_1145056280 6 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056280 17:19706035-19706057 TCAGGGTGGCAGTGTGAGGGAGG 0: 1
1: 0
2: 7
3: 59
4: 493
1145056272_1145056281 7 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056281 17:19706036-19706058 CAGGGTGGCAGTGTGAGGGAGGG 0: 1
1: 0
2: 7
3: 65
4: 673
1145056272_1145056279 3 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056279 17:19706032-19706054 AACTCAGGGTGGCAGTGTGAGGG 0: 1
1: 0
2: 1
3: 22
4: 232
1145056272_1145056276 -8 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056276 17:19706021-19706043 CTTTCCAGATGAACTCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1145056272_1145056282 8 Left 1145056272 17:19706006-19706028 CCCTGTGTGGTCTGTCTTTCCAG 0: 1
1: 0
2: 2
3: 17
4: 251
Right 1145056282 17:19706037-19706059 AGGGTGGCAGTGTGAGGGAGGGG 0: 1
1: 0
2: 9
3: 117
4: 934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145056272 Original CRISPR CTGGAAAGACAGACCACACA GGG (reversed) Intronic
902470832 1:16646847-16646869 CTGGCAGGACAGGCCACCCACGG - Intergenic
902487968 1:16760601-16760623 CTGGCAGGACAGGCCACCCACGG + Intronic
903484041 1:23676495-23676517 CTGGAGGGACAGAGCACCCAGGG - Intergenic
903548788 1:24143247-24143269 CTGGAATTCCAGAGCACACAGGG - Intergenic
903605241 1:24570746-24570768 CTGGTGATGCAGACCACACATGG + Intronic
904388367 1:30162263-30162285 CTGGGAAGTCAAACCACAGAGGG + Intergenic
905508249 1:38497772-38497794 CTGGGAAGAAATACAACACATGG + Intergenic
905904748 1:41610530-41610552 CTGGTAAGACAGGCCAGAGAGGG + Intronic
912202455 1:107473453-107473475 ATGGAAAAACTGACCACAGATGG - Intronic
912247350 1:107973874-107973896 CTGGACAGGCAGAACACAGAAGG + Intergenic
916008359 1:160681857-160681879 TTGGAAAGACAGACCAGCCAAGG - Intronic
916185559 1:162129204-162129226 GAGGAAAGACAGATCACAGAGGG - Intronic
916791469 1:168129113-168129135 CTGTAAAGAAAGATCAAACAGGG + Intronic
917103979 1:171473756-171473778 ATGTAAATACAGATCACACATGG + Intergenic
917772342 1:178293496-178293518 CTGGAATACCAGACCACGCATGG - Intronic
918536733 1:185583066-185583088 CTGGAGAAAAAGAGCACACAGGG + Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919311983 1:195922460-195922482 ATGAAAAGACAAACCACACATGG + Intergenic
919359795 1:196578328-196578350 CTGGAAAGACAAGTCACTCAGGG + Intronic
920189015 1:204180546-204180568 CTGGAGAGTCTGCCCACACAAGG - Intergenic
921180796 1:212629865-212629887 CCTGAAAGACAGAGCACACATGG + Intergenic
922187468 1:223288261-223288283 CAGGAGAGAGAGAGCACACAGGG - Intronic
923548725 1:234944137-234944159 CTGGAAAGCCAGCCCTCACCTGG - Intergenic
1063064477 10:2594588-2594610 CTGGAAAGTCAGAGTCCACAGGG - Intergenic
1063900337 10:10726314-10726336 CTAGAAAGGCAGAAAACACATGG - Intergenic
1064267477 10:13836704-13836726 CTGGAAAGACTGACTAACCAGGG + Intronic
1064998372 10:21315871-21315893 CTGGAAAGAAAGACCTCATCTGG + Intergenic
1065971669 10:30810580-30810602 CTGGAAATGCAGACCCCCCAGGG + Intergenic
1066650858 10:37653883-37653905 ATGGAAAGAGAGACCACATAAGG + Intergenic
1067059378 10:43070204-43070226 CTGGACAGACAGAGCAAGCAGGG + Intergenic
1067945383 10:50685465-50685487 CTGAAAAGACACCCCACCCAGGG + Intergenic
1068449331 10:57165556-57165578 CTGCAAAGACAGAGCCCTCATGG - Intergenic
1070557015 10:77536384-77536406 CTGGGAAGAAAGACCACAGCAGG - Intronic
1071419374 10:85476265-85476287 CTGGAACCACAGACCTCATATGG - Intergenic
1071515953 10:86297788-86297810 CTGGACAGAAAGTCCACCCATGG + Intronic
1071633805 10:87234560-87234582 CTGAAAAGACACCCCACCCAGGG + Exonic
1071647254 10:87366776-87366798 CTGAAAAGACACCCCACCCAGGG + Exonic
1072196426 10:93120477-93120499 CTGGAACCACAGACCCCTCAGGG - Intergenic
1072984739 10:100129785-100129807 TAGGAAAGACAGGCGACACAGGG - Intergenic
1074467014 10:113692308-113692330 CTGCACAGAAAGTCCACACAGGG + Intronic
1075573752 10:123563541-123563563 CTGGGAAAACAGACCCAACAAGG - Intergenic
1075780435 10:125013844-125013866 CTGGAAAGACAGACATCATCAGG + Intronic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1079274907 11:19026298-19026320 CTGGAAAGACAGAGTAAACATGG - Intergenic
1084440442 11:69169772-69169794 CTGGAAACACCGAGGACACACGG + Intergenic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1086450855 11:86915253-86915275 CTGGTAAGACAGAAAACTCAGGG + Intronic
1087437762 11:98144606-98144628 CAGGAGAGAGAGAGCACACAGGG + Intergenic
1088053453 11:105547265-105547287 CTAGCAAGACAGAGAACACATGG + Intergenic
1088835819 11:113577351-113577373 CAGGAAAGCCAGACCAGCCAAGG + Intergenic
1090270701 11:125383993-125384015 CTGGGGAGACAGACCAGAGAGGG + Intronic
1091267802 11:134284051-134284073 CTAGAAAGACTCATCACACAAGG + Intronic
1093017235 12:14166872-14166894 AAGGGAAGGCAGACCACACAGGG + Intergenic
1093266095 12:17005607-17005629 CTGCACAGACAGACCTCACGGGG - Intergenic
1093513195 12:19953145-19953167 CTAGAAAGCCAGCACACACATGG + Intergenic
1093668513 12:21843870-21843892 CTGGAAAGTCAGAAAAGACAAGG + Intronic
1096872079 12:54599265-54599287 TTTGGAAGCCAGACCACACAGGG + Intergenic
1097334246 12:58364524-58364546 ATGGGGAGACAGAACACACAAGG + Intergenic
1098393962 12:69998513-69998535 CTTGAATAACAGTCCACACAGGG + Intergenic
1100107159 12:91189788-91189810 CTGGAAAGTAAAACCACATAGGG + Intergenic
1101421777 12:104556629-104556651 GTGTGAAGACAGAACACACAGGG - Intronic
1102403848 12:112655082-112655104 CTTGAAGGCCAGACCACAAAGGG + Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1102795236 12:115683557-115683579 CAGGAAAGAAAGGCCACGCAGGG + Intergenic
1102799141 12:115716373-115716395 CTGAACAGACACACCACCCAAGG - Intergenic
1104627561 12:130371153-130371175 CTGGAATTACAGAAAACACACGG - Intronic
1105522674 13:21144779-21144801 CTGGAAAGACAGTCCTTAGAAGG + Intronic
1108234166 13:48385129-48385151 CAGGAAAGACAGATCATATAGGG - Intronic
1108497496 13:51040000-51040022 CTGGACAAACAGCCCACTCAGGG + Intergenic
1111596106 13:90413079-90413101 CTGGAAAAACACAGCACACCAGG + Intergenic
1114334986 14:21679692-21679714 CTGTAAAGACAGAACAGACAAGG - Intergenic
1116274157 14:42808654-42808676 CAGGAATGACAAACCAGACAAGG - Intergenic
1117434254 14:55701066-55701088 TTAGATAGCCAGACCACACATGG - Intronic
1119424186 14:74525063-74525085 CTGGACAGACACAGCTCACAGGG + Intronic
1120397014 14:83980812-83980834 CTGGAGAGACAGACAAAATAAGG - Intergenic
1120847459 14:89138977-89138999 CTGGAAGGACAGTGCACGCAGGG - Intronic
1123899560 15:24862928-24862950 CAGGAAGGACAGACCATAAAGGG + Intronic
1125966802 15:43881257-43881279 ATGGAAAGAAAGGCCACAGAGGG + Intronic
1126221536 15:46219937-46219959 TTGGAAAGACAGAACAGATAAGG + Intergenic
1127236344 15:57056734-57056756 CGGGAAAGAGACACCACACCTGG + Intronic
1129099778 15:73249738-73249760 CTGGAACGATATACCACACTTGG + Intronic
1131710732 15:95053415-95053437 TTGAAAAACCAGACCACACAAGG - Intergenic
1133389509 16:5398046-5398068 CTGCAAAGAAAAACCACACGGGG + Intergenic
1135849845 16:25953398-25953420 CTAGAAAGCCTGACCTCACAGGG + Intronic
1135994388 16:27237357-27237379 CTGGAAAAACAGGCCATCCAAGG - Intronic
1136097244 16:27965933-27965955 ATGGAGAGACAGATCACAGAGGG - Intronic
1137442361 16:48508084-48508106 CTGGGAACAGTGACCACACATGG + Intergenic
1137951628 16:52789305-52789327 GAGGAAAGACAGACCACACTGGG + Intergenic
1138913688 16:61435809-61435831 CAGCAAAGACAGACCACAGAAGG + Intergenic
1139058113 16:63212449-63212471 GTGGAAAGACAACCCAGACATGG + Intergenic
1141966585 16:87449230-87449252 TTGTAAAGACAGACCACAACAGG - Intronic
1142134362 16:88444819-88444841 CTGGAAAGACAGACACCCCTGGG - Intergenic
1144189429 17:12830688-12830710 CTGGAAAAAAAGACCTTACAGGG - Intronic
1144307845 17:13985269-13985291 GTGGAAAAAAAGAACACACAAGG + Intergenic
1145056272 17:19706006-19706028 CTGGAAAGACAGACCACACAGGG - Intronic
1146460669 17:33043780-33043802 TTGGACAATCAGACCACACAGGG + Intronic
1146648770 17:34593353-34593375 CTGGCAAGGCAGAACGCACAGGG - Intronic
1150635325 17:66909070-66909092 CTGGAAACACAGACCCTAAAGGG + Intergenic
1151064749 17:71136575-71136597 CTGAAAATACAGACAATACAGGG - Intergenic
1152264743 17:79287733-79287755 CTGGAGGGACAGAGCCCACAGGG + Intronic
1152317561 17:79589783-79589805 CTGGAAGGACAGACCCCCCATGG - Intergenic
1152678075 17:81651686-81651708 CTGCAAGGACAGAGCACTCAGGG + Intronic
1155018466 18:21871794-21871816 GTGGAAAGAAAGAACACAGATGG - Intergenic
1155256749 18:24004558-24004580 GTTGAAAGAAACACCACACAAGG - Intronic
1155551632 18:26971793-26971815 CTGGAAGGACAGAGCGCCCATGG + Intronic
1155574442 18:27229457-27229479 CTGGCAAGACACAGCATACATGG - Intergenic
1158106566 18:53891344-53891366 CAGGAAAGACAGAGGAAACAAGG + Intergenic
1159555922 18:69944607-69944629 CTTTAAAGGCATACCACACAAGG + Intronic
1159886683 18:73914321-73914343 ATGGAAAGCCACACCACAGAGGG - Intergenic
1161178702 19:2864882-2864904 CTGACATTACAGACCACACATGG - Intergenic
1162662123 19:12178234-12178256 GTGGAAAGGCAGGCAACACACGG - Intronic
1163200812 19:15767629-15767651 CTGAAAAGCCAGACCACAGGGGG - Intergenic
1163717581 19:18880838-18880860 CAGGAAAGCAACACCACACACGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1202703231 1_KI270713v1_random:3639-3661 CTGGCAGGACAGGCCACCCACGG - Intergenic
926433324 2:12813341-12813363 CAGGGAAAACACACCACACATGG - Intergenic
927428505 2:23007206-23007228 CTGCAAAGCCAGATCCCACAAGG + Intergenic
927989359 2:27436586-27436608 CCTGAACTACAGACCACACATGG - Intronic
928964615 2:36965025-36965047 GTGGAAAGAGCGAACACACAAGG - Intronic
932286688 2:70539874-70539896 GTGGAACCACAGACCACACCTGG - Intronic
934861254 2:97765097-97765119 CTGGACACACGGACCACCCACGG + Intronic
937704089 2:124897801-124897823 TTGGAAAGACAAAACACATAAGG - Intronic
938019103 2:127891672-127891694 CAGGAAAGAAAAACCACACCAGG + Intergenic
939061932 2:137432693-137432715 CTGGAAGGACAGAAGACACGTGG - Intronic
940762963 2:157758218-157758240 CTGTAAAAAGAGACCACAAAAGG + Intronic
941031104 2:160512569-160512591 TGGTAAAGACAGACCTCACAGGG - Intergenic
941799115 2:169635353-169635375 ATGAGAAGACAGACCAAACATGG - Intronic
942169542 2:173276369-173276391 CTGGAAAGTCAGATCAGGCATGG - Intergenic
943434958 2:187853756-187853778 ATGAAAAGACAACCCACACAGGG - Intergenic
945575010 2:211519690-211519712 CAGGAAAGAAAGGCAACACAAGG + Intronic
946480347 2:220049841-220049863 CTACAAAGTCAGACCACAGAGGG - Intergenic
1170932983 20:20785593-20785615 CTGAAAAGTCACACCACAGATGG - Intergenic
1172782103 20:37443030-37443052 CAGGACAGACAGACCACCCTTGG - Intergenic
1174697588 20:52576032-52576054 GGGGAAAGACAGAGCACAAAAGG - Intergenic
1175177543 20:57121580-57121602 CTGAGAACATAGACCACACAGGG - Intergenic
1175612973 20:60367173-60367195 CTTGAACGAGAGACCAAACAAGG + Intergenic
1175647720 20:60689339-60689361 CTAGAAACTGAGACCACACATGG - Intergenic
1175692509 20:61075790-61075812 CTGAAAAGTCACACCGCACATGG + Intergenic
1177421030 21:20857144-20857166 CTGCAAAGACAGAGCAATCAGGG - Intergenic
1177530871 21:22356107-22356129 ATGGAATGACACTCCACACAAGG + Intergenic
1178438686 21:32581354-32581376 CTGAAAAATCAGATCACACATGG - Intronic
1178759266 21:35385085-35385107 CAGGAAAGACAGACCTAACATGG - Intronic
1179587925 21:42385546-42385568 TTGGAAAGACAGACCCGACGTGG + Intronic
1181148882 22:20868744-20868766 CTGGAAAGGCAGCTCACAGATGG + Intronic
1183413100 22:37666762-37666784 CTGAAAACACTGACCGCACAGGG - Exonic
1183961118 22:41412575-41412597 CTGGAAAGACAGGGCAGACGAGG - Intergenic
1184200715 22:42967345-42967367 CAGGAAAGGCAGCCAACACAAGG + Intronic
1184602535 22:45552125-45552147 CTGGGTAGACAGCCCACAGAGGG + Intronic
949293478 3:2493468-2493490 CTGGAGATGCAAACCACACACGG + Intronic
949759510 3:7453818-7453840 CTGGACAGACAGGCCTCACCAGG - Intronic
949951416 3:9231912-9231934 CTCAAAAGACAGACCAGAGATGG + Intronic
950098938 3:10345689-10345711 CAGCACAGCCAGACCACACAGGG + Intronic
950647607 3:14386647-14386669 CTGGAGAGACAGGCCTCACCAGG + Intergenic
951944455 3:28119157-28119179 TTGGAAAAACAGGGCACACAAGG + Intergenic
953563462 3:44012468-44012490 CAGGAAAGACAGAGCTCACCGGG - Intergenic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
956070920 3:65450173-65450195 CTAGAGAGGCTGACCACACAGGG + Intronic
956152081 3:66253994-66254016 CGGGTAATACAGACTACACAAGG - Intronic
957412991 3:79864205-79864227 CCAGAAAAACAGAACACACAGGG + Intergenic
957511120 3:81188891-81188913 CAGGAAGGACAGGCCAGACACGG + Intergenic
958863310 3:99470278-99470300 CTGAACTGACAGAACACACAGGG - Intergenic
961590758 3:127979033-127979055 TTGGAAACACAGCCCACAGAAGG + Intronic
961593683 3:127999772-127999794 TTTGCAAGACAGACCACAGAAGG + Intergenic
961654072 3:128432139-128432161 GTGGAAAGACAGGCCAGAGATGG + Intergenic
962130165 3:132664083-132664105 CAGGAAAAACAAACCAAACAAGG + Intronic
963304920 3:143640716-143640738 CTGGGACCACAGACCACACCAGG - Intronic
963328941 3:143892708-143892730 CTGGAATGCTAAACCACACAAGG - Intergenic
964716054 3:159723026-159723048 CTGGAAGCACTGAGCACACATGG - Intronic
965732145 3:171783432-171783454 GTGGAAAGTTAGACTACACAGGG + Intronic
965778252 3:172256201-172256223 CTGGAAGGACAGGCCAAAAAAGG - Intronic
965931743 3:174051943-174051965 CTAGAAAGACAGAGAACCCATGG - Intronic
966225021 3:177588992-177589014 CAGGAAGGACAGAAAACACAAGG - Intergenic
969660478 4:8524708-8524730 GTGCAAAGACAAACCACAGATGG + Intergenic
971029404 4:22620688-22620710 CTGGAAGGACAGAGCGCCCATGG + Intergenic
971534308 4:27729279-27729301 GTGGAAGGACAGAAAACACATGG + Intergenic
971826574 4:31631035-31631057 CTGGAAAGTCAGGCTCCACATGG + Intergenic
972583580 4:40416647-40416669 CTGGAAAGACATGCCAGTCAAGG - Intergenic
974923588 4:68271290-68271312 CAGGAGAGACAGAGCACGCAGGG + Intergenic
974995194 4:69147379-69147401 CTGGAAAACAAGAGCACACATGG - Intronic
975502808 4:75105723-75105745 CTGAAAAAATAGACTACACAAGG - Intergenic
981400400 4:144307367-144307389 CAGGAATGAAAAACCACACATGG - Intergenic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
983888192 4:173004280-173004302 CTGGAAAGACAGAAGACACTAGG - Intronic
985249414 4:188008329-188008351 CTGGAAAAATAAACCAAACATGG - Intergenic
985619133 5:944481-944503 CTGGAAGCACAGGGCACACAAGG - Intergenic
985733596 5:1565013-1565035 CTGGAAATCCAGACAACACTGGG - Intergenic
986361395 5:6981632-6981654 CTATAAAGACAGGCCACACTGGG - Intergenic
989731970 5:44659686-44659708 CTGGAAAAAAATACCACAAAAGG - Intergenic
992737715 5:79740285-79740307 CTAGCAAGAGAGACAACACAGGG + Intronic
996711179 5:126545224-126545246 CTGGAAAGACATACCATACATGG + Intronic
996819966 5:127615638-127615660 CAAGAAAGAGAGAGCACACAGGG - Intergenic
998999947 5:147909553-147909575 TTGGAAGGCCACACCACACAAGG - Intergenic
999970326 5:156854032-156854054 CTGTAAAGAGAGACCACAGAAGG + Intergenic
1001422671 5:171599435-171599457 CTGGGAGGAGAGCCCACACAAGG - Intergenic
1001813652 5:174649694-174649716 CTGGAAACCCAGACAACATAGGG - Intergenic
1002341561 5:178519517-178519539 CTGGGAGATCAGACCACACAGGG - Intronic
1002531320 5:179847609-179847631 CTGGTAGGACAGACCCCACTGGG - Intronic
1003362283 6:5439474-5439496 TTGGAAAGGCAACCCACACAGGG - Intronic
1004653793 6:17638382-17638404 CTGGAGAAACAGATCACAGATGG - Intronic
1004840496 6:19578500-19578522 ATGCACACACAGACCACACATGG + Intergenic
1004968107 6:20877860-20877882 CTAGAAATAGAGACCACAGATGG - Intronic
1005618769 6:27600815-27600837 CTGGAAAGCGCCACCACACACGG - Intergenic
1006015600 6:31078391-31078413 CTGGAGAAACTGACCAGACAAGG + Intergenic
1007016900 6:38477894-38477916 GTGGAAAGACAATTCACACAAGG + Intronic
1008405321 6:51112623-51112645 CTGCAAAGACAGCACACCCAGGG + Intergenic
1009418590 6:63441518-63441540 CTGTACAGACAGACCACAAGTGG + Intergenic
1010742725 6:79527196-79527218 CTGGTAAAACAGACCCCAGAAGG + Intronic
1012488724 6:99753131-99753153 CTGGGAACACAGTCCACAGAGGG + Intergenic
1013120311 6:107135009-107135031 CTGAAAAAACATAACACACAGGG - Intergenic
1013893187 6:115050991-115051013 GTGGAATGACAGTCCACACTGGG + Intergenic
1013923500 6:115439724-115439746 GTGGGAAGACAGACAACAAATGG + Intergenic
1016805699 6:148210235-148210257 CTGCAAAAACAGACCAGGCATGG + Intergenic
1017321978 6:153105068-153105090 GTGGACAGACAGATCACACTGGG + Intronic
1017714492 6:157199478-157199500 CTGGAAAGCCACACCACGAAGGG - Intronic
1019296274 7:277057-277079 CTTGAAACACAGCACACACATGG + Intergenic
1019800581 7:3085225-3085247 CAGAAAAATCAGACCACACATGG - Intergenic
1019835223 7:3376873-3376895 CTGGAAAGAGAGACAATAGAAGG - Intronic
1021088458 7:16451997-16452019 CTGGAAGGTGAGAGCACACAGGG - Intergenic
1022974062 7:35541171-35541193 CTGGATAGACAGGCCAGACTTGG - Intergenic
1023722313 7:43109580-43109602 ATGAAAAGACAAGCCACACATGG + Intergenic
1026104648 7:67411194-67411216 GTGGAAAGACAGGCCAGACGTGG + Intergenic
1027333700 7:77126694-77126716 GAGGATAGACAGACTACACAAGG - Intronic
1027406480 7:77867199-77867221 CTGGCAAGATAGCCCACAGAAGG + Intronic
1027508919 7:79054557-79054579 CTGGAAAGAAAGACCAGAATGGG - Intronic
1028288519 7:89035200-89035222 CTGAAAAGAAAGAACAAACATGG + Intronic
1030175578 7:106649894-106649916 CTGGAAGGAGAGAAGACACAAGG - Intergenic
1030807487 7:113935798-113935820 CAGGAGAGAGAGAGCACACAGGG + Intronic
1032806330 7:135358451-135358473 TTGGAGAAACAGACAACACAAGG + Intergenic
1032915224 7:136482084-136482106 CTGGGAAGGCAGATAACACATGG + Intergenic
1033290708 7:140080449-140080471 TAGGAAAGACAGACGAAACATGG + Intergenic
1033982592 7:147184544-147184566 CTGAAAACACAGCCCACACCAGG + Intronic
1035299023 7:157885227-157885249 CTGGAACGACAGCCCCCACCAGG + Intronic
1036766271 8:11551092-11551114 CTGAAAAAACAGACAAGACATGG - Intronic
1037631112 8:20657170-20657192 CAGAAAAGACAGACTACAGAAGG - Intergenic
1039378111 8:37057778-37057800 CAGGAGAGAAAGAGCACACAGGG - Intergenic
1039923689 8:41910407-41910429 AGGGAAAGACACACCACAGAAGG + Intergenic
1041083942 8:54239931-54239953 ATGGAAAGAAATACCACCCAAGG + Intergenic
1041346739 8:56906903-56906925 CTTAAAAGACAGACTACAGAAGG - Intergenic
1042433286 8:68734229-68734251 CTGGAACAACAGACCCTACATGG - Intronic
1043573352 8:81630029-81630051 CTGAACAGACAGACCTCACTGGG - Intergenic
1043780772 8:84332440-84332462 CTGAAAAGACAGAGGACAAAGGG + Intronic
1045058499 8:98391236-98391258 CTGGAACTACAGCCCACAGAAGG - Intergenic
1046782394 8:118229798-118229820 CCGGAATGAGAGGCCACACACGG + Intronic
1047441318 8:124880895-124880917 GTGGAGAGTCAGGCCACACAGGG + Intergenic
1049266243 8:141669363-141669385 AGGGAAAGACACAGCACACAGGG + Intergenic
1049816280 8:144604118-144604140 CCAGAAAGACCAACCACACAGGG + Intronic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1051540829 9:18215705-18215727 CAGCAAAAACAGAACACACAGGG - Intergenic
1056984902 9:91353896-91353918 CTGGAATTACAGGCCACACATGG - Intronic
1058562185 9:106241876-106241898 TTGGAAAGTCAGGCCATACATGG - Intergenic
1058580757 9:106454009-106454031 TTGGACACACAGAACACACAGGG - Intergenic
1058795193 9:108490907-108490929 TTGGAAAGACAGAAAACAGACGG - Intergenic
1059026844 9:110643540-110643562 CTAGAAAGACAGACAATATAGGG - Intergenic
1059877563 9:118652432-118652454 CAGGAAAGAAAGAACACACAAGG + Intergenic
1061315838 9:129795308-129795330 CATGAAGGACTGACCACACAAGG - Intergenic
1186052118 X:5607927-5607949 CTGGAAAGACTGACAAGCCAGGG + Intergenic
1186231288 X:7457217-7457239 TTGGAAAGACACACCAGCCATGG - Intergenic
1187831382 X:23385430-23385452 CCGGGTAGACAGACCACCCAGGG - Intronic
1188457832 X:30387488-30387510 CTGTAGAGACAGACCAGCCATGG - Intergenic
1188715431 X:33454655-33454677 ATGGAAAAACATTCCACACAAGG + Intergenic
1188839687 X:35001107-35001129 CTGAGAAAACAGACTACACATGG + Intergenic
1190094498 X:47467671-47467693 CTGGAAAGACAGTGTCCACATGG + Exonic
1192203945 X:69083772-69083794 CTGAAAGGACAGACTAGACAGGG - Intergenic
1196498701 X:116351800-116351822 CAGGAGAGACAGAGCACACAGGG - Intergenic
1197318075 X:124992710-124992732 CTGGACAGACAGACCATGCTGGG + Intergenic
1197866559 X:131025320-131025342 CTGGAAAGGCAGAGCCCAGAGGG + Intergenic
1200835484 Y:7727530-7727552 CTGGAAAAACAGACCCCGCTAGG - Intergenic
1202270018 Y:23062310-23062332 CATGGAATACAGACCACACAGGG + Intergenic
1202296009 Y:23358372-23358394 CATGGAATACAGACCACACAGGG - Intergenic
1202423012 Y:24696055-24696077 CATGGAATACAGACCACACAGGG + Intergenic
1202447777 Y:24974031-24974053 CATGGAATACAGACCACACAGGG - Intergenic